Transcript asmbl_46059

Sequence
Transcript Sequence for observation asmbl_46059 of TGE0005816:
CAGGATTCTTTTGTAGAACTCTCTCTTGGAATGATATTTTCATCATGAGCCAACAAGGTTATGTGGCGACACCACCCTATTCTCAGTCCCAGTCTGGGATGGGCCTTTCTCCACCGCATTACGGACACTATGGGGACCCGTCTCATGCAGCTCCTCCCCCAGGCATGATGAAGCCGGCAGGGCCTCTGGGGGCCGCTGCACCAGGGGCGATGTCACCACAGGGCCCTCCACCTCCTGGACCCCATCAGTTCAGCCAGAACGGAGCGCACGCCCAGGGTCACCCTTCCCAAAGATTTCCAGGACCTCCACCTGTCAACAGTGCAGCACCCTCATATGCACCGTATTCACCTGCCACACAGTCATCTTACGCAAGCCCCATGCCCGCCCCATCCGTCTCCCAGCTGGGCAGTCAGCTCGGTGCCGTGCACATCAACAGCTATGGTAACCAGTCAGGTCCAGCCCCCTCCAGCCAGGGCCCCCCGGGCCCTCCGTCAGCGCCATCATTCCAGGGCCCTCCACAGCCACCGCCACCATCCATCCTGCAGCCTGGGCCTCAAGTCCTTCCGCCACCACCCACTGCGCTCAATGGCCCAGGGGCGCCACCCCTGCCTCCGCCCACGCACAGGCAGGACGGGCTCGCTGGGCCCGCTCCCGCGAGGGCCCCGCTGCAGCCCCCACCTCTCCTGGGACAGGCTGTGGCCGCCGGCTACCCTCCGCAGCCAGCCAACTACAGCCCACAGATGCCAGGGGCGCAGCTCTCGTTCCCAGGAGGCTTCCCTGCAGGGCCCGCACAGATGGCAGGGCCACCTCCGCCCCAGAAGAAGCTGGACCCTGACTCTATCCCCAGTCCAATCCAGGTGATCGAGAATGACAGAGCTGCCAGAGGGGGACAAGTGTACGCCACCAATACCAGAGGCCAGGTCCCTCCCCTGGTCACCACAGACTGTGTGGTCCAAGACCAAGGCAACGCTAGTCCTCGGTACATTCGCTGCACGACGTACTGCTTCCCGTGCACGTCCGACATGGCCAAGCAAGCGCAGATCCCGCTAGCCGCGGTCATCACGCCCTTCGCCACCATTCCTTCAAATGAGACTCCCCTTTACTTGGTGAACCATGGAGAGACCGGGCCGGTCAGGTGCAACAGGTGCAAAGCCTACATGTGCCCGTTCATGCAGTTCATAGAGGGAGGACGGAGGTTCCAGTGTGGCTTCTGCAACTGCGTGAGCGACGTCCCGCCGTTCTATTTCCAACATCTGGACCACATGGGAAGAAGACTGGACCACTACGAGAAGCCGGAGTTATCTCTAGGATCTTACGAATACGTTGCTACTTTGGATTACTGCAGAAAGAGTAAGCCTCCCAGCCCGCCCGCCTTCATCTTCATGATCGACGTCTCCTACAGCAACATCAAGAACGGGCTCGTGAAGCTCATATGCGAGGAGCTGAAGACCGTGCTGGACAAGCTGCCCAAGGAAGAGCAGGAAGAGACTTCTGCCATCCGCGTCGGCTTCGTCACATACAACAAGGCCCTCCATTTCTTCAATGTCAAGAGTAATTTGGCCCAGCCTCAGATGATGGTGGTGACCGACGTGAGCGAGGTCTTCGTCCCTTTGCTGGATGGTTTCCTTGTCAACTATCAAGAATCCCAATCTGTGATTCACAATTTGCTGGACCAGATTCCCGAGATGTTCGCGGACTCCGCTGAGAACGAGACTGTCTTTGCCCCTGTCGTCCGGGCCGGCATGGAGGCCCTGAAGGCGGCGGACTGCCCCGGGAAGCTGTTCGTCTTCCACGCCTCGCTGCCCACCGCCGAGGCCCCGGGGAAGCTGAAGCCCAGGGACGACAGGAAGCTGGTGAACACGGACAAAGAGAAGATGCTGTTCCAGCCCCAGACCAGCGTCTACGACTCGCTGGCCAAGGACTGCGTGGCCCGGCTGCTCCTTTTTTTTTCCCAGTCAGCACGTGGACGTGGCCTCCCTGGGCCTCGTGCCCCATCTCACTGGAGGGACCCTTTACAAGTACAGCAACTTCCAGATGCACTTGGATAGCCAGCAATTCTTGAATGACCTCAGAAATGATATTGGGAAGAAAATAGGATTTGACGCCATAATGCGGGTCCGCACCAGCACAGGATTTAGAGCCACTGATTTCTTTGGCGGAATTTTTATGAACAACACCACCGATGTGGAGATGGCGGCCATCGATTGTGACAAGGCAGTGACTGTGGAGTTTAAGCACGATGACAAACTTAGTGAAGACAGTGGGGCCTTAATCCAGTGCGCTGTGCTTTACACGACCGTCGGCGGTCAGAGGAGACTGCGGATTCACAACCTTGGCCTGAACTGCAGCGCCCAGCTGGCCGACCTCTATAAGAGCTGTGAGACGGACGCCCTCATCAACTTCTTCGCCAAGTCAGCTTTCAAAGCAGTCCTGCACCAGCCCTTGAAGGTCATCCGGGAAATTCTCGTTAACCAGACCGCCCACATGTTGGCCTGCTACCGGAAGAACTGTGCCAGCCCATCCGCAGCCAGCCAGCTCATTCTGCCGGATGCCATGAAGGTGCTGCCCGTGTACATGAACTGCTTGCTGAAGACCTGCGTGCTGCTCGGCCGGCCGGACGTCGCGGTGGACGAGCGCGCCTTCCAGCGCCAGCTGGTCCTGACCATGGGTGTGGCCGACTCGCAGCTCTTCTTCTACCCGCAGCTCCTGCCCATCCACACGTTAGACGTCACGAGCACGGCAGTGCCCGCTGCCATTCGCTGCTCCGAGTCGCGCCTTTCGGAGGACGGAGTGTTCCTGCTGGTGAACGGCCTGAACGTGTTCCTGTGGCTGGGCGCCAGCAGCCCGCCCGAGCTCATCCAGGGGATATTCAGCGTGCCGTCGCTGGCACACGTCAGCACAGACATGACGTTACTGCCTGAGGTAGGAAACCCGTATTCTCAAACACTCAGGACAATAATGAGTACCATCCAACAAAAGAGGCCATATTCAATGAAGCTCGTGATCGTAAAGCAGCGAGAACAGGCAGAAATGCTCTTCCGGCAGCTCCTGGTGGAGGACAAGGGACCCCACGGAGGGCCGTCTTACGTGGATTTCCTCTGCTGTGTGCACAAGGAGATCTGTCAGCTGCTGAATTAGCGGAGCCTTCTGTGTTGGCGTTGCGTTTCTAGGGAAATCATCTCCTTCTTGGCGGCTGATTCTCCAGATGACAGCGGGCTCGCTTTGATTCCTTGCTCCTTTTCAGAGTGGCTTTCCACAGCATTCAGACCTTCAGCTTTGGTGCTCAGGTGCGAAGCCAGCGAAGGGACAGCTGTACCTCAAAGGGAACAGTCTGTTTCTATTGTACAATTTTTAACTGTTAAGACTGATGATATACTTTTGCATTTCATGAAAGGCACAGTTTTACAAAACTGTAAACATTCTCAATTTTCCTTCTTTGTGCCAGACATTTAAATTATTTTTCAAAATGTATAGATTTGGGGAAAAGGTTGTCTTGGCTCATCTCCTATTTGCAGTGAGAGGAAAAAAACTTAATTTTTACATTATATCTAATTTTTTTAAACCACGTAACCCCACTGAACATTTTCCACTTGAGGTTTGCATAGCGGACTTTTAATAACCTTGGAATCTATTGGTAGGACCATGTGCGTTCTACATTTTTTTCATAATTCTATGTTGTGTATGTTAAACTATTTTCCGATTGTCTATAAAATTGTCTATCAATACTCTCAAATGGTTCTCTGTACAATAATGAAGGTTTCTACCTGTATATAATGGATCTTAACCAGTATCAATAAATCCCTTCGTATGCTCTA