Transcript asmbl_4195

Sequence
Transcript Sequence for observation asmbl_4195 of TGE0000273:
CTGAACGCCTGACGTCAAGGCGACACCGCCAAACCTCGCCCAGAGTCAGGCGTGGAAAGCAGCCCGAGCGGCGGCGGCGGCGGCGACGGCGACGGCGGCAGCGGCAGAGACCGCCGTGGCGCCGGGAGCAGCGACCCGAAGGGAACGCGCGGCGACGGCGAGGGCGACGGCGGCGACCCGGTGACAGCGCGAGAGGTACTAAGTGTGACAGTGTGCACCATGCGTGAATATAAGCTCGTCGTGCTTGGATCAGGAGGCGTTGGGAAGTCAGCCCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAGCAGTGTATGCTTGAAATCTTGGACACTGCAGGAACGGAGCAATTCACAGCCATGAGGGACCTGTACATGAAGAACGGACAAGGCTTCGCTCTGGTTTACTCCATCACAGCACAGTCGACATTTAACGACTTACAAGATCTAAGAGAGCAGATTCTGCGGGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGCAATAAATGCGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAACCTAGCAAGACAGTGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAGTCCAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCGTGTCAGCTGCTTTAATGTACTGAATGCATTGTAGCTCTGAGCCAGGTCTGAAGAACTGTTGCCCAATTCAGCAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAACGGACTTTCCTGTGGTGGTACCCTGAGAGGCGGATGAAAGCTACTCTGTCAGTTTGCACATTCTAATCACTTTCCAGTATCACGAGAGATTTTTACTTATATAATAGTTCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACATCCAGTATTACTGCTAAGAGACATTCTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACACCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAATTCAAGGTCATTATCATTGTATTATACAAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTCAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGATTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCCTTATTATATGTTTCCTTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGACTCCCTTGCTTGCTCATGCATATGTGTGTCTGCAATACCAAATATACAGGTTTAGTATCTGCCTGTTAGTGATTGTTTCCCATGTGTAACGTTTCGGTTGAGATGTTAACTGGTGGACGAGTACTGTGGATGTGAATGTGGGATGTCATTTTAATCATGTGTAACTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGTTTTGTATGCATAAATGTTTGGGTGTAAAGATTGTGTGTCCATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTGATGTTACAACGACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATAACTTAGCATCCGTAGTTCAATAAATTTGGATTGCCGTGCAAGGGCTTGCATTATAGTTACTTGCCACTGAATGTGTTTTGTGTAATGTTTTAACAGTGCTAGTAAATAAATATGGGTTTACCTTTTTAAATGTAATAGGTGTTATTTTACACAGTGTGATTTCATAATTTATACCGTATAGGTAAATCAGACTCTTAATTCCAAGAATGATGAATGAAAGATATCAGGGTTCAGTTTTGGTTTTGTTTTCTTTTCTTTTCTAGAATTGTTTGACTATCCACATAAAACCACCCTTTGAACTTTTCTTTGAGAAAGAATGTTATAAAGCAAGCAGTATTACTTAGGGACAATGCCTTTGGCTGGTGTTCAGTAACTCTGTGGGGAAAGGAGGAAGGATTCAAATACTTTGGGTACTGCACTATGGATTTTCTTTTTTCTGATAGAATACAAATCTTTGGGGAATTAATACACAGAAATTTCCACCATTTATGCTCAAAATATTACTATGGTTATACAATTTTTGATGTGGATTCATGCTACTTTTCTTTTATTATCTCTGTCTTATGTGTGCTATGATTGAACTCTGTGAAATTTATAAAGAAGCTCTTAAACGTTTTCATAGTACTTGCCAGCTGCTGGAGCAACTACTTAGTGGTACCTTCTAGTTTGCAGGTGTGCCAGTCCTCCACACGTGCTGTTTGAAATGGGACATTAAAG