Transcript asmbl_41204

Sequence
Transcript Sequence for observation asmbl_41204 of TGE0010302:
TCTGCTCTCTGAGCCTCCTCCTGGACCTCCTTCCAGCTCTCTAAGTGGGAGGGGGATCCCTGTGGGTGGGGTCTTCTCCAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGACTGCTAGGGACACCGACTGAGGAACAATGGCCTGCCATGACCAAGCTGCCAGACTATAAGCCCTACCCAATGTACCCAGCTACAACATCCTTGGTGAACGTCGTGCCCAAGCTCAATGCCACGGGGAGGGACCTGTTGCAGAACCTATTGAAGTGTAACCCTGTGCAGCGCATCTCAGCAGAGGAGGCCTTGCAGCACCCCTACTTCTCTGACTTCTGTCCCCCATAGGCTCTCTGAACCCCAGTGGCCAGGCTGGGGCCTGGCCTGTTTAAGCCTCCCTCCCAGGAGGGTGGAAGAGTCGGGTGTGGGATGCTGAGCGCCAGCTGTGCTGGGCCAGCCAGGGCAGAGTTACCCTGGCCCGCGGCTTTCCCTCCCTCCGTGGACTTTATTTAATTTCATAAATTGGCTCCTTTCCCACAGTCTGATGATATGGTGGTGGGGTGGCTCTGGAGGGTGACTGGGGACTCCTGCAATGTGATGTGGCCCACAGCTTGTGCACTGAGCTACTCACGTCTGCTCTATCTCTTTACGTATCCTGAGACCAGGAATAGGAGGCAATGGTCCCTGTTCTTTTGATTGTGTCATGGCAGTCCTGTCTCCACACTCAGCTTACATAATCCTCCACACTTTTTTCCTCTGCCTAGAAGGCCAGATACAGTCCTGAGGTAGGATGCCTGAGTGCAAAGCTGAGTCTTTGCCAGAAGGGGAGAATGGGCCAGGCCTCTCTAGCTCTGCATCCTATATAGAGCCTTCCACATCTGTCTTCTCACACTTGGAGTTG