Transcript asmbl_40803

Sequence
Transcript Sequence for observation asmbl_40803 of TGE0040697:
CAGAGCTCGGTGCCCGGCCTGGAGGACAGCGGTGTCGCGAGTCGGCGATCGGTGGTCCGCGGCAACGCCGAGAGGCCGTACGGGAACGCGGGCGCCGGAGCTCAGAGGTAACGCGGGATGGACCCGGACCCGGCGCGCAGGGAGTGGGCGCGAGCTCCGTGCGCGAGTTGACTCTTCACCACACTGAAGCCGTTAGGAAAACAAACCTTGTGGTTATCAGCAGAGCCTTCAGAGTTTCACCATAACTCAGGCCTAGACATTATTCTAAATGGCAACTGATATGTCTCAAGGTGAACTCATCCATCCTAAGGCACTCCCACTTATAGTAGGAGCGCAGCTGATCCACGCGGACAAGTTAGGTGAGAAAGCAGAAGATACCACCATGCCTATACGTCGAGCCGTGAATTCTACCCGGGAAACTCCACCCAAAAGCAAACTTGCTGAAGGGGAGGAAGAAAAACCAGAAGAACAGGAGAATGAGACTCCACCTGCTACATCCAGTGAGGCAGAGCAGCCCAAGGGGGAGCCTGAGAGTGGAGAGAAGGAAGAGAACAACAACAAGTCTGCTGAGGAACCCAAAAAGGATGAGAAGGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAGACGATTCCTGCCTGGGCGACTCTCTCTGCCAGCCAGCTAGCCAGGGCCCAGAGACAAACCCCCATGGCTTCCTCCCCACGGCCCAAGATGGACGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGACTGGCGCCTCGGTGGTTGCGATTCGAAAGTACATCATTCATAAGTACCCGTCTCTGGGTCTGGAGAGAAGGGGCTATCTGCTCAAGCAAGCGCTGAAGAGAGAGTTAAACAGAGGAGTCATCAGACAGGTAAAAGGAAAAGGTGCATCTGGCAGTTTTGTTGTGGTCCAGAAATCAAAACCACCTCAGAAATCCAAAAACAGAAAGAAGGGCTCGGCTCTGGATCCAGAACCACAAGTAAAACTGGAAGATGTTCTCCCGTTGGCTTTTACTCGGCTCTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATACGTGTCTCAGTATTACCCTAAGCTCAGAGTGGACATCAGGCCCCAGTTGTTGAAGAATGCTCTGCAGCGAGCAGTAGAGAGAGGCCAGCTCGAGCAGATAACTGGCAAGGGTGCTTCGGGGACATTTCAGCTGAAGAAATCAGGGGAGAAGCCCCTGCTGGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAACGAGCCTAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGGCCAACTCTAACTATCAGATGCATTTGCTGAAAAAAACCCTGCAGAAATGTGAGAAGAACGGGTGGCTGGAGCAGATCTCTGGGAAGGGGTTCAGCGGCACCTTCCAGCTGTCCTTCCCCTACTACCCTAGCCCAGGAGTTCTATTTCCGAAGAAAGAATCCGGTGGCTCTGACGATGAAGATGAAGATGACGATGACGATGAATCATCAGAAGACTCTGAGGATGAGGAACCACCACCCAAGAGGAGCTTACAGAAGAAAACACCAGCCAAGTCCCAAGGGAAGACAGCCTCCATGAAGCAGAGAGGGTCGAAGCCTGCGCGGAAAGTCCCGGCTGCCCAGAGAGGGAAAGTGAGGCCGCTGCCTAAGAAAGCTCCACCCAAGGCCAAGACCCCTGCCAGGAAAGCCAGACCCTCTCCCTCAGTCATCAAGAAGCCTAGTGGGAGCTCCTCCAGAAAGCCCATAGCCAGTGCACGAAAGGAAGCGAAACTGCCCGGGAAGGGCAAATCTGCCATGAAGAAGTCTTTCAAGACAAAAAAGTAAATTTTATAGGGAAAAGGGTATCATGATTGAATTCAGAATCTTACTTTATAAGGTCAGTGTGCATTTGTTCTAGTTATAATGCTTTTAAATTGTACTTTTTCTTCCCATGTGAGCATTGTGGGAAGGAATGGACACAGAGCAGCGTAGACATTTGTGAGCTTCGGTGCTGTTCAGTGCCTGCTTCTTCATCACCTTAATTTCTGCCATAACCTGGACTTCGCTGACTGTGTGACTGCCCTGCTCCCTCTGTTCATCTTAGCCCCAGCCCTCGTCCTCTTTCTGTGATCCGATTGAGGATTTTTTCCTCCTTCAAGTTAATTTAAACAACTGCAGAGATGTGTTTGTAGAGCACTTAGAGGTCTGGGGCTGGAAGTCCAGACGGCGCAGGAGCAGTGTTGGGAAGGCTTTGCGTCCTGCCTGCAGACTTGCTAGAGCTGTGGTGATTAACCCTGGCTGTTGAATCACTCCACTGACCAGTCTCCAGCTTGAGTCGGGGACATGTTAACTTCGGAAAGAAGCCCCCGTCCCTGCCATCCCATAGATTCTGAAGGGCTCCTCTCCTCCGGTCACGCTGACCAACTGCCAAGCTCGCTTTGCTGCCCAGAGCACTGTCCCCTCACAGCAAGCACAAGTTGTCTGCACCACTTGGTTTCTGACTGAAGGGGAAGTACAGGACTACATGGAATCTGATTTCTGGTGTTGCTTATTACCAAAAATGACAGAATATTCTTGATCAAATGTCTAGATATATTTTTAATATTTGGGGCATGAGTTGTCCCTGTTTGAGAGTTCCCATTACTAATGTAGAAATGTTAAATGGTAAAACATAATTTGCTAAAATGACCAGTTTTCAGATTCACCTGTGCGTGTGCCCCCCACTCCCATCCCACCCTGTTCTTTCCATAGAACTTTTGATATCAGGCAAACGGTTTCCTTTTTGAGATATTTTAACAGAGAAGGGGTGGGGGAGAAGCAGATGAAGCTGTACTACCCAGCCCTCTTCTTGTTTGTATTTGTTTAGGGTTGTGAGGTTGTGTAAAATAGTACTAGCTTCTTACTTGAGAACTACAGTTTCTGCTTATCATTTATTCTTCCTTGTGGCACTTAATATTTTAATTGTCTTAAGCTTTTTGATGTATATATCCTCTGGCCCCTTACATGCTGCCAGAGGAGAAGGTGTTTGTTTGAGATTCATTCCACTTGAAGTGTCTCCTGGGATCCCCACAGCTGCGTATGGCTGGGAAATGGACTTAAGGCTTGGGCTTGAATTGGTGGCTCCTACCTGTGAGGTCCCATCGTGAGTCACTGGGATTTGTGTTGCATGGAAGGCAGTCTTTCCTGTTGTAAATCTTCCTTTTTTATGTACAAATATTTTGAAAAATATGAATAAACATGAACTTTTAAAAGCTGCTGAACTACAGCTTAGTGAAAAGTTTCCAGTACCTGTCCTGCAATCTCTCCTCCTGCAAGGGATACCATGGCTTCCTTTTTCTTTTGAGTTCTTAC