Transcript asmbl_38058

Sequence
Transcript Sequence for observation asmbl_38058 of TGE0040583:
CAGGCGCGTGCCCCTGTCCGGCAGCCGAGGAGGCCCCGCGCAGTGCTGCCAACGCCCCGGCGGAGAAGCTGAGGACAAGATCTAATTTGAAATATTAAAAGTGGATACAAAACTGTTTCCGAAATGCAGACAATTAAGTGTGTTGTTGTTGGTGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTCCCATCGGAATATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATACACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGACTACGACCGCTAAGTTATCCACAGACAGATGTTTTTCTAGTATGTTTCTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATTACTCCAGAGACTGCTGAAAAGCTGGCGCGGGATCTGAAGGCTGTCAAGTATGTGGAGTGCTCTGCCCTCACACAGAGAGGTCTGAAGAATGTGTTTGATGAGGCTATCCTAGCTGCCCTCGAGCCTCCGGAAACTCAACCCAAAAGGAAGTGCTGTATATTCTAAACCGTTTTCTCCTTCCCCTCTTTGCTGCTGCTTCCTGTCCCACTACTGTAGAAAGATCATTTAAAACAAAGGAATAAAACCATCCTGTTTGAAAGCCTCTGC