Transcript asmbl_37354

Sequence
Transcript Sequence for observation asmbl_37354 of TGE0002736:
CGGCGGTGCGCGCTACGGAGCTCGGCCAGCCTGCTCCGTCCTGACTCACCGCTGTTCGCTCCTGCTGAGGAACAAGTCGGTCAGGAAGCCGCGCCTCAGCCATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGCTCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAATCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGTGGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGCAGATGCCTAAGACAACTGAATAAATCGTCTTAATGGTCAAA