Transcript asmbl_45550

Sequence
Transcript Sequence for observation asmbl_45550 of TGE0005759:
CCCCGTTGCCGCCCCCTCCGGAGCCTATAAGTTGCTCGCGGCGCCAGGGCGCCTGCACGTCGGTCCGACTCCGGCCGTGGGTCCGCGGCGCGCGCTTGGCCCCACTCGCTGCCCCCGCAGTCCTGGCCCGGGGCGGACCAGTGGTCCCCGCGCTCTCGCGAGAAGTTCGCCGCCGTAGGGCGGTGGGATGCCAGAGCCCTCACGGGCCCTGGAGGGGCGGAAGATGGGGTGGTGCGCAGAAAAGCCGCAGCTTTTGCTGCTGGCTCTCATCCTCCAGCCCTGGACTCCCTGCCTAGGTGCAGACTCGGAGAAACCCTTCAGCATCCCCACAGATAAATTATTAGTCATAACTGTAGCAACAAAAGAAAGTGATGGATTCCATCGATTTATGCAGTCAGCCCAATACTTCAATTATACTGTGAAGGTCCTTGGTCAAGGAGAAGAGTGGAGAGGTGGTGATGGAATTAATAGTATTGGAGGTGGCCAGAAAGTCAGATTAATGAAAGAAGTTATGGAACATTATGCCAGTCAAGAGGATCTGGTTGTCTTGTTTACTGAATGCTTTGATGTCATATTTGCTGGTGGTCCAGAAGAAGTTCTAAAAAAGTTCCAAAAGTCAAACCATAAAGTGGTCTTTGCAGCTGATGGAATTCTGTGGCCAGATAAAAGACTAGCAGACAAGTATCCCATTGTGCACATTGGGAAACGCTACCTGAATTCGGGAGGATTTATTGGTTATGCTCCATATATCAACCGTATAGTTCAACAGTGGAATCTACAGGATAATGATGACGATCAGCTATTTTATACTAAAATTTACATTGATCCACTGAAAAGGGAAGCTATTAATATCACATTGGATCACAAATGCAAAATTTTCCAGGCCTTAAATGGAGCTGTAGATGAAGTTGTTTTGAAATTTGAAAATGGCAAAGCCAGAGCTAAGAATGTGTTTTATGAAACATTACCAGTGGCAATTAATGGAAATGGACCCACCAAGATTCTTCTGAATTATTTTGGAAACTATGTACCTAATGCATGGACACAGGATAATGGCTGCACTCTTTGTGAATTGGATACAATTGACTTATCTGCAGTAAATGTCTATCCAAATGTAACAATAGGTGTTTTTATTGAACAACCAACCCCTTTCCTATCTCGATTTCTGGATGTATTGTTGACACTGGATTACCCTAAAGAAGCACTTAAAGTCTTTATTCATAACAAAGAAGTTTATCATGAAAAGGACATCAAGGTATTTTTTGATAAAGCTAAACATGAAATCAGTACTATAAAAGTAGTAGGACCAGAAGAAAATCTAAGTCAAGCTGAAGCCAGAAACATGGGAATGGATTTTTGCCGTCAAGATAAGAACTGTGATTACTACTTTAGTGTAGATGCAGATGTGGTTCTGACAAACCCAAGGACTTTAAAAATTTTGATTGAACAAAACAGAAAGATCATTGCCCCTCTTGTAACTCGTCATGGAAAGCTTTGGTCCAACTTCTGGGGAGCATTGAGTCCTGATGGATACTATGCTCGATCAGAAGATTATGTGGATATTGTTCAAGGGAATAGAATAGGGATATGGAATGTCCCGTACATGGCTAATGTCTACTTAATTAAAGGAAAGACGCTCCGATCAGAGATGAATGAAAGGAACTATTTTGTTCGAGATAAACTGGATCCTGATATGGCTCTTTGCCGAAATGCTAGAGAAATGACATTACAAAGGGAAAAAGACTCCCCTACTCCGGAAACATTCCAAATGCTCAGCCCCCCAAAGGGTGTATTTATGTACATTTCTAATAGACATGAATTTGGAAGACTATTATCAACTGCTAATTACAATACTTCCCATTATAACAATGACCTCTGGCAGATTTTTGAAAATCCTGTGGACTGGAAGGAAAAGTATATAAACCGCGATTATTCAAAGATTTTCACTGAAAATATAGTTGAACAGCCTTGTCCAGATGTCTTTTGGTTTCCCATATTTTCTGAAAAAGCCTGTGATGAATTGGTGGAAGAAATGGAGCATTATGGCCAGTGGTCTGGAGGCAAACATCATGATAGCCGTATTTCTGGTGGTTATGAAAATGTCCCAACTGATGATATCCACATGAAACAAATTGATCTGGAGAATGTATGGCTTCATTTTATCCGGGAGTTTATTGCACCTGTTACACTGAAGGTCTTTGCAGGCTATTATACAAAGGGGTTTGCATTACTGAATTTTGTGGTAAAATACTCCCCTGATAGACAGCGTTCTCTTCGCCCTCATCACGATGCTTCTACATTTACCATCAACATTGCACTCAATAGTGTGGGAGAAGATTTTCAGGGAGGTGGATGCAAATTCCTAAGGTACAATTGCTCTATTGAATCACCAAGAAAAGGCTGGAGCTTCATGCATCCAGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGACATTTCTTTGGAATGGATGACTGGTATGAACATATTTTTGAAGTTGTGCTTGAGAAGATGAGAGGAATATTTAAATATTCCACAGAACAACCTAACTTTGGGCCAAACATTTGAAAAACTTTATAAAAAATTGTTTGATATTTCCTAATGTCTGCTCTGAGCCTTAAAACACAGATTGAAGAAGAAAGGAAAAAAGTAAACACAAATATTTATTTCTGTGCCTTATTGTCTTTGAGAATAATGAGAATTTTCTGAATTTGTGTTTCAGTTGATAAAATATTCAGGTACAAATGTACAAGCAACAAATGAGACTGGTAATATTTTATTTAACAAAAGCCTAAGAAGAATTTTATTTATCAACATATAGATGAAGTGAATATAAATGAAAATTGGCAATTTTTAAAATGTCTAAAAACTGGAATTCTAACTGAATTTGTGTGCAACTTATTGTGTAAGTACTTTTTGACCACCTATGCAAGTATGTTTTAAAGTATAGTTCCTGAAGGAATACCAAGAACAATATTACAGTTTTTTTCCTTGAGAAAATTAGTATAAAATGCAATTAGGTGCATACCCAGTTGAAAACATTTTTGTTTAGATTGTTAGACAGACTTTTTTTTACATTTGTATTAGAAATCAAGCCCTGTGTTCCTTCAGATAAATTTTCCAAGGTAGATTATAGTAAATAGATACTAGATTTAGAAAAGCTTTCAAGCCTTTCCATTTCTTATTGACTTAAGATCACCAAGTGACCTTAAGTCAAAAAGGTTGTCGTTCTTTTAATTCTAGAAAATAATGAGGAAATTTTTTTCTTTGAGATTAGTAGTAGCATTTTGATTTTAAAAAATTAAGTACTTGAATTTTATATCAGGAAAATAAAGTTGGTGAGCCTTTCTTCCTTTTTGCCCTTTGTCTCCCTCTTTATGTTCTTTTTTGTGAAGGTTATCCTCTTTTTTGTCTTCCCAGCGTAGTCTCCATTTTATCCTTCTTACTCTTTTTATTACCTTCTCTTTATCACACTTTAGAATAATTTCCTAGCACAAAAAAATTTGTGACTTGATTTTTCACCATTTCTCTGAGTGAGGTTTAAATATCCTTATTGTAGCTACTGTTTTTAATTTAAAGGTTAAACTTGAAAAAAAAGTTCTAAGTCATGGTGCCAAAATTTATTTTTCTAACACTGTGTGTTAGAAAATTATGAAAAATAAAATAATTTAAAATAA