Transcript asmbl_20328

Sequence
Transcript Sequence for observation asmbl_20328 of TGE0000588:
CGGCGGCCTCCCGGGGCCGCTGGCCACCTCTGCGGCTCCTCCCGGGCCTCCAGCGGCCGCCTCCCCCTGCCTGGGGCCTGTGGCCGCTGCCGGGAGCGGGCTCCGCCGGGGAGCCGAAGGCATCTTGGCGCCGCAGCCGCCGCCGCCGCAGCAACACCAGGAGAGGCCGGGGGCAGCCGCCATCGGCAGCGCCAGGGGACAGAGCACAGGAAAGGGACCCCCACAGTCACCTGTGTTTGAAGGCGTCTACAACAATTCCAGAATGCTGCATTTCCTTACAGCTGTTGTGGGCTCCACTTGTGATGTAAAGGTGAAAAATGGTACCACTTATGAGGGTATCTTCAAGACGCTAAGCTCAAAGTTTGAACTAGCCGTGGATGCTGTGCACCGGAAAGCATCTGAGCCAGCAGGTGGCCCTCGTCGGGAGGACATTGTGGACACCATGGTGTTTAAGCCAAGTGATGTCATGCTTGTTCACTTCCGAAATGTTGACTTCAACTATGCTACTAAAGACAAGTTCACCGATTCAGCCATTGCCATGAACTCGAAAGTGAATGGGGAACACAAAGAGAAGGTGCTTCAGCGCTGGGAGGGGGGTGACAGCAACAGCGACGACTATGACCTCGAGTCTGACATGTCCAATGGATGGGACCCCAATGAAATGTTCAAGTTCAATGAGGAGAACTACGGTGTGAAGACTACCTATGATAGCAGTCTTTCTTCTTATACGGTGCCCTTAGAAAAGGACAACTCAGAAGAGTTTCGTCAGCGAGAGCTGCGTGCGGCCCAGTTGGCTCGAGAGATTGAATCAAGCCCCCAGTACCGCCTACGGATCGCCATGGAGAACGACGATGGGCGCACTGAAGAGGAGAAGCACAGTGCAGTCCAGCGGCAGGGCTCAGGGCGGGAGAGCCCCAGCTTGGCATCCAGGGAGGGGAAGTATATCCCTCTGCCTCAACGAGTCCGGGAAGGTCCCCGGGGAGGAGTTCGATGCAGCAGCTCTCGGGGCGGTCGGCCTGGCCTTAGCTCTTTGCCACCTCGTGGCCCTCACCATCTGGACAACAGCAGCCCTGGCCCAGGTTCTGAGGCCCGTGGTATCAATGGAGGCCCTTCCCGCATGTCCCCAAAGGCACAACGGCCTCTGAGAGGTGCCAAGACTCTGTCTTCGCCCAGTAATAGGCCTTCTGGAGAAACTTCTGTTCCACCTCCTCCTGCAGTGGGCCGGATGTATCCCCCGCGTTCTCCCAAGTCTGCTGCCCCTGCCCCAATCTCAGCTTCCTGTCCAGAGCCTCCCATCGGCTCGGCAGTGCCAACCTCTTCAGCCTCCATCCCTGTGACCTCATCAGTCTCAGATCCTGGAGTGGGCTCCATTTCTCCAGCTTCTCCAAAGATCTCCCTGGCCCCCACAGATGTAAAAGAACTCTCTACCAAGGAACCTGGGAGAACTCTGGAGCCCCAGGAGCTGGCTCGGATAGCTGGGAAAGTCCCTGGTCTTCAGAATGAACAGAAACGATTCCAACTGGAAGAACTGAGAAAGTTTGGGGCCCAGTTTAAGCTTCAGCCCAGTAGCTCCCCTGAGAACAGCCTGGATCCTTTTCCTCCCCGGATCTTAAAGGAGGAGCCCAAAGGAAAGGAGAAAGAGGTTGATGGTCTGTTGACTTCAGAGCCCATGGGGTCTCCCGTCTCCTCCAAGACAGAGTCCGTATCGGATAAGGAGGACAAACCACCCCTGGCACCATCAGGAGGCACTGAGGGGCCAGAGCAGCCCCCACCACCTTGTCCAAGCCAAACTGGCAGCCCCCCGGTGGGCCTCATCAAGGGAGAAGACAAAGATGAGGGCCCTGTTGCTGAACAAGTAAAGAAATCAACGTTGAACCCTAATGCTAAGGAGTTCAATCCTACAAAGCCTCTGCTGTCTGTGAATAAATCCACCAGTACCCCAACTTCTCCGGGGCCCCGGACTCATTCAACTCCCTCCATCCCGGTGCTGACAGCAGGCCAGAGTGGGCTATACAGCCCCCAGTACATCTCCTACATACCTCAGATCCACATGGGACCAGCTGTGCAGGCACCTCAGATGTATCCATATCCTGTATCCAATTCAGTGCCTGGGCAGCAGGGCAAGTACCGGGGAGCAAAAGGCTCCCTTCCTCCGCAGCGCTCGGACCAACACCAGCCAGCCTCAGCCCCGCCGATGATGCAGGCCGCCGCGGCTGCTGGCCCGCCTCTGGTGGCTGCCACGCCCTATTCTTCCTACATCCCCTACAACCCTCAGCAGTTCCCAGGCCAGCCAGCCATGATGCAGCCCATGGCCCACTACCCCTCACAGCCGGTGTTTGCCCCCATGCTTCAGAGCAACCCACGCATGCTGACGTCGGGCAGCCATCCCCAGGCCATCGTGTCATCCTCTACCCCTCAGTACCCTTCTGCAGAGCAGCCTACCCCCCAAGCCCTTTATGCCACTGTTCACCAGTCCTACCCACACCATGCCACACAGCTCCATGCCCACCAGCCGCAGCCGGCTACCACGCCTACTGGAAGCCAGCCGCAGTCCCAGCATGCGGCCCCCAGTCCTGTCCAGCATCAGGCGGGGCAGGCCCCACACTTGGGCAGTGGACAGCCACAGCAGAATCTGTACCACCCAGGGGCCCTGACAGGCACGCCGCCCTCTCTGCCACCGGGACCTTCTGCCCAGTCCCCTCAGAGCAGCTTCCCCCAGCCAGCCGCTGTGTATGCCATCCACCACCAGCAGCTGCCCCACGGCTTCACCAACATGGCCCATGTTACCCAGGCCCATGTCCAAACTGGAATCACAGCAGCCCCGCCCCCTCACCCTGGGGCTCCCCACCCGCCCCAGGTGATGCTGCTGCACCCACCCCAGAGTCATGGGGGGCCCCCCCAAGGCGCGGTGCCCCAGAGTGGGGTGCCTGCACTCTCAGCTTCCACACCCTCACCCTACCCCTACATCGGACACCCCCAAGGTGAGCAGCCTGGCCAGGCGCCTGGATTTCCAGGAGGAGCCGATGACAGGATTCGTGAGTTCTCATTAGCTGGGGGAATTTGGCATGGAAGAGCTGAGGGGCTGCAGGTGGGGCAGGATGCACGGGTTCTGGGTGGGGAGTGAGGGGTCTTGGAGGCAGGGCTGTCCCACAGGGCGCCCGCCGACCTGCACCTGTCTGTGAAGTATGTAGGGTGGGCAGAAGCCACAGTCGCCGCCGCCAGGGGCTTGCTCCTGGCTCTGTCCTTTGCTTCCCTCCGTCCTCGCTCAGTTGTGATCCAGCAGCCCCCCTCCCCACTGCCTCCCCAGCTCTCAGTGACCCCGACTGTCTCCTGACTTAGCCGAGGTAAGGTCAGTGCAGCAGACAGGGCCAGACTGGGGTGTGGGGGGCTGAGCTGGGCACATGAGTGAGGGCTCTGGCTTACTGGGAAACAGCGATTGACCTGTGCTTCTGACAGCCCCCGAGACACCTTGAGGAGGCCGCTCCTTCCCAGACACACCCCCACGCCCCCACTGGACGGCATTGGAGGAAGGGACAGCTGCTTGGGTTCTAATGCTCCTGCTCTCTTCTCTTTCCCCTCCAACCAGTTCAATCTCATCCCTCCCAGCAGCTCCCCTTCCACCCCCCGGGGAACTGAAGATTGTCCTGGCCGCGACCTGAGACCTCCATGAGTGGAGGGAAGAGTGATCTATGTCTCTTCCCCCAGCAGCTCGGACCACTCCCAGCCCCCCATCCCCCCGTTCCCCAGGGGAGCTGGGGAATTCCTGCCAAGCACCTTGAATGGGAGGGGCCTCACAGAGGGCAGGGCCAGGGTCCAGCAGGGGTGGGGGGTTCCTGCTCTGCCCCTGCCCGTCCCCACCCAGTCTTGCCCTCCCATCCTCTCATCTATTCCCCCGCTGGAGACGGAAGATCTTTTATTTTCTATTATTTATAACTTCAGACTTGGGCCCCCTGTTCTTTCTTTCCCATTAACTTGAGTGACCTGTGTGAGAGACAGACAGATGCCCCACGAGGATGGCTGGACAAGGACTTTTACTTTTTATTACATAAAAAT