Transcript asmbl_4523

Sequence
Transcript Sequence for observation asmbl_4523 of TGE0005748:
CCGGTCCTAGCCCGGGAAAACGCCCTCTGCGGTGAAGGAGAGATCACGCCGCCATGCCTCGCTCTGGGTCGCGAGCAGTCTTCCTCCTCTTGTCGCCGCTGCTGCTGCTCCGCGCTGTTTTGACTGTGCCCCTGGAGCGAGGGGCGCCCAAGGAGGAGAGCCCCGCGACCGAGAGCCCCGACACGGGCCTGTACTACCACCGGTACCTCCAGGAGGTCATCAATGTCCTGGAGACTGATGGGCACTTCCGCGAGAAGCTGCAGGCCGCCAATGCCGAGGACATCAAGAGCGGGAAGCTGAGCCGGGAGCTGGACTTTGTCAGCCACCACGTCCGCACCAAGTTGGACGAGCTCAAGAGGCAGGAGGTGTCGCGGCTTCGGATGCTGCTCAAGGCCAAGATGGACGCAGAGCAGGAGCCCAATGTACAGTTGGACCACTTGAGCCTCCTGAAGCAGTTCGAACACCTGGACCCTCAGAACCAGCACACATTTGAGGCCCGAGACCTGGAGCTGCTGATCCAGACGGCCACCCGCGACCTTGCCCAGTACGACGCGGCCCATCACGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCGTTATCTGGAGTCACTGGGAGAGGAGCAGCGGAAGGAGGCAGAGAGGAAACTGGAAGAACAACAGCGACGGCACCGAGAGCACCCCAAAGTCAATGTGCCTGGCAGCCAAGCTCAGTTGAAGGAGGTGTGGGAGGAGCTGGATGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGATATCAACAGCGATGGTGTCCTAGATGAGCAGGAGCTGGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTATATGACCCGAAGAATGAGGAAGACGACATGCGGGAGATGGAGGAGGAGCGACTGCGCATGCGGGAGCACGTGATGAAGAATGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTATGGGGACACCGGGGAGGGCTGGGAGACGGTGGAGATGCATCCTGCCTACACGGAGGAAGAGCTGAGGCGTTTCGAGGAGGAGCTGGCCGCCCGGGAGGCAGAGCTGAATGCCAAGGCCCAGCGCCTCAGCCAGGAGACAGAGGCTTTGGGGCGCTCCCAGGACCGCCTGGAGGCCCAGAAGAGAGAGCTGCAGCAGGCGGTTATGCAGATGGAGCAGAGGAAGCAGCAGCAGCAGCAGCAGCAGC