Transcript asmbl_4520

Sequence
Transcript Sequence for observation asmbl_4520 of TGE0005748:
CCTCTGCGGTGAAGGAGAGGTGCGCGGCTGGCGGTTTCCAGACTCGGGTCCTGGGAAGGCGGCGAAGAGAGGGGCCAGAGGGCTGGAAGACTGAGTCCCAGCGGAGGGCGAGCCGGATCACGCCGCCATGCCTCGCTCTGGGTCGCGAGCAGTCTTCCTCCTCTTGTCGCCGCTGCTGCTGCTCCGCGCTGTTTTGACTGTGCCCCTGGAGCGAGGGGCGCCCAAGGAGGAGAGCCCCGCGACCGAGAGCCCCGACACGGGCCTGTACTACCACCGGTACCTCCAGGAGGTCATCAATGTCCTGGAGACTGATGGGCACTTCCGCGAGAAGCTGCAGGCCGCCAATGCCGAGGACATCAAGAGCGGGAAGCTGAGCCGGGAGCTGGACTTTGTCAGCCACCACGTCCGCACCAAGTTGGACGAGCTCAAGAGGCAGGAGGTGTCGCGGCTTCGGATGCTGCTCAAGGCCAAGATGGACGCAGAGCAGGAGCCCAATGTACAGTTGGACCACTTGAGCCTCCTGAAGCAGTTCGAACACCTGGACCCTCAGAACCAGCACACATTTGAGGCCCGAGACCTGGAGCTGCTGATCCAGACGGCCACCCGCGACCTTGCCCAGTACGACGCGGCCCATCACGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCGTTATCTGGAGTCACTGGGAGAGGAGCAGCGGAAGGAGGCAGAGAGGAAACTGGAAGAACAACAGCGACGGCACCGAGAGCACCCCAAAGTCAATGTGCCTGGCAGCCAAGCTCAGTTGAAGGAGGTGTGGGAGGAGCTGGATGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGATATCAACAGCGATGGTGTCCTAGATGAGCAGGAGCTGGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTATATGACCCGAAGAATGAGGAAGACGACATGCGGGAGATGGAGGAGGAGCGACTGCGCATGCGGGAGCACGTGATGAAGAATGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTATGGGGACACCGGGGAGGGCTGGGAGACGGTGGAGATGCATCCTGCCTACACGGAGGAAGAGCTGAGGCGTTTCGAGGAGGAGCTGGCCGCCCGGGAGGCAGAGCTGAATGCCAAGGCCCAGCGCCTCAGCCAGGAGACAGAGGCTTTGGGGCGCTCCCAGGACCGCCTGGAGGCCCAGAAGAGAGAGCTGCAGCAGGCGGTTATGCAGATGGAGCAGAGGAAGCAGCAGCAGCAGCAGCAGCAGC