Transcript asmbl_34862

Sequence
Transcript Sequence for observation asmbl_34862 of TGE0001954:
ACGCGCAGACGGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTTTCACATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCTGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCATAAGTCTATGACTCTGAAGGAGGCCATCAAGTCCTCGCTCATCATCCTCAAGCAAGTCATGGAGGAGAAGCTGAATGCAACCAACATCGAGCTAGCCACGGTGCAGCCTGGTCAGAATTTCCACATGTTCACAAAGGAAGAACTGGAGGAGGTGATCAAGGACATTTAAGAAGGAGCCGTCCTCGAACTTCTGTGGGACACTTTCAGTTCTAATTGCCCTTAGACTTTATTTCCAGCTCTTATGTCATGGAAAATATCCAGTATATGTGTGTGTGTTTTTTTATGAAGTCTGTACATAACAGCAATTCTGAAATAA