Transcript asmbl_3337

Sequence
Transcript Sequence for observation asmbl_3337 of TGE0003685:
CGCAGGCCCAGAAGCTTGCAAGCCGCGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAGTCGGACCGGGCTGGGCTCGCTAAAGGAGAGGCACCGCGGAGGGGCAGGCCAGCGTCGCGTCGCGATCCGGGATGTCGAAGAACACGGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGACGAATATGACGAGAACAAGTTCGTGGACGAGGAGGACGGCGGCGATGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCGTGCCTACGGCAAGGAAACATGACAGCTGCTCTCCAGGCTGCTCTGAAAAACCCCCCTATTAACACAAAGAGCCAGGCAGTGAAGGACCGTGCAGGCAGCATCGTCTTGAAGGTGCTTATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTGCAGTCTCTGGACAAGAACGGTGTGGACCTCCTAATGAAGTATATTTATAAAGGCTTTGAGAGCCCATCTGACAACAGCAGTGCTGTGTTGCTCCAGTGGCATGAAAAGGCCCTTGCTGCTGGAGGAGTGGGGTCCATTGTTCGAGTTTTGACTGCAAGGAAAACCGTGTAGTCCAGCTGGAACTGGACACCGTTCACAGAAGTGGGAGTTGCTGGTATAAAGACCAAAACAACCAAATGGCACCGCTGCCCTGTGGGTAGCATCTGTTTCTCTCAGCTTTGCCTTCTTGCTTCCTTTTTCATATCTGTAAAGAAGAAAATTACATATCAGTTTCCTTTAATGAAAATTGAAATAATGTGGAGAAAATTTTGTCTCAGTGGGGATGTTTGACCCTTTCATAACCATGTCAATAATATGTATCACATTCTGTAATTTATATTCAAGTTTGATTGTGCAATTTCTAACTCTGTTGCCTGGTTTAAGGGTTTTACTTTATTTTTAACCAATACTGAGAGATGTGATCAAAGTTGAGGCCAGTTTCCTAACTCATTGCTGGTCAGGAAGTGATCTTTATTTTTAAAAATGAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCACACTTCCCTTATTTAAGCAAAATGTGTTTCCAGGGCAAGTAGTGGGTGAGCCCTACTACCAGTTTCCAGCCTTCTTTCCGCTTGCCTCCAGATGATGCTATAAGTGTAAGTGTGCTACTTCCTGTTAGCATCCAACTTTCATGGCCTCTCAATCTCTTTGTGGTGACCCAGGGTCCGGAGCAAGGAGTCTTGCTCTATATAAATGTATTTACACAATATAAGCGCCTCTTTGGCACAAACATCCCATTTCCTTCTGGTAATAAGGCTGCCTGGGGAAACAGTCCCAAGTCAGAGACAGGCCTCCAGCAGCCTCTGGATGAAATACTTTCATCAGAAATAAGGTAGCTGCCTTAGCCATTACACAAGTGTTCACTGGAACATTTCCCATGATTTCCCGAGGACGTCTTCAGTGTTCTTCAGGTAATGGGGATCTCAGAAGATTTGGTTCTGATCCAAAGACACAGTCTGTGTTTCAGCTCAGTGTTTTTAAGAAAGAAAAATGCCACATAGTAAAAGAAAAAAAGTGTTTACTTCGTTGGACAAACCAAATTGATTCTCAAAAAATGACCGGTGCTTGTAAAAAGTTATTACAAAGTAGTTCCGAAACCAACCACCTGAATGTGCGTGGCCGAGAGGGAATCAGCCTGCTTGTCTTTCCCTAAGATGCCAACTCCAGAGTCACTGACTGAGGTGAGAACCAGCGCAGAAACTCTATAAACTGCTGTTTTTGATACCTGCTCTTTTTGTTTTGTTCTGTTTTGTAAAATTATGATAAACTTCAGAAAATAAAATGTCAGTGTTGAATAA