Transcript asmbl_20289

Sequence
Transcript Sequence for observation asmbl_20289 of TGE0000584:
AATTGGACTGGTCCAACCTTATAAAGAGAGCAGTAGAGCGCGGCAGTATAGAGAGTACCTCACGAAGGGGACGTGGGAAAGTGTTAGCGGGGAACGCTGGGAAACTCCCGGCCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAGCTACTAACCAGAGCCGGCTCTTTCTCGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGTTAAAGCCACAGCTGCGCCTGCAGGAGCACCGCCACAACCTCAGGACCTTGAGTTTACCAAGTTACCAAATGGCTTGGTGATTGCTTCTTTGGAAAACTATTCTCCTGTATCAAGAATTGGTTTGTTCATTAAAGCAGGCAGTAGATATGAGGACTTCAGCAATTTAGGAACCACCCATTTGCTGCGTCTTACATCCAGTCTGACGACAAAAGGAGCTTCATCTTTCAAGATAACCCGTGGAATTGAAGCAGTTGGTGGCAAATTAAGTGTGACCGCAACAAGGGAAAACATGGCTTATACTGTGGAATGCCTGCGGGGTGATGTTGATATTCTAATGGAGTTCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGTTGGGAAGTAGCTGACCTTCAGCCTCAGCTAAAGATTGACAAAGCTGTGGCCTTTCAGAATCCGCAGACTCATGTCATTGAAAATTTGCATGCAGCAGCTTACCGGAATGCCTTGGCTAATCCCTTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAGGAGTTACATTACTTCGTTCAGAACCATTTCACAAGTGCAAGAATGGCTTTGATTGGACTTGGTGTGAGTCATCCTGTTCTAAAGCAAGTTGCTGAACAGTTTCTCAACATGAGGGGTGGGCTTGGTTTATCTGGTGCAAAGGCCAACTACCGTGGAGGTGAAATCCGAGAACAGAATGGAGACAGTCTTGTCCATGCTGCTTTTGTAGCAGAAAGTGCTGTCGCGGGAAGTGCAGAGGCAAATGCATTTAGTGTTCTTCAGCATGTCCTCGGTGCTGGGCCACATGTCAAGAGGGGCAGCAACACCACCAGCCATCTGCACCAGGCTGTTGCCAAGGCAACTCAGCAGCCATTTGATGTTTCTGCATTTAATGCCAGTTACTCAGATTCTGGACTCTTTGGGATTTATACTATCTCCCAGGCCACAGCTGCTGGAGATGTTATCAAGGCTGCCTATAATCAAGTAAAAACAATAGCTCAAGGAAACCTTTCCAACACAGATGTCCAAGCTGCCAAGAACAAGCTGAAAGCTGGATACCTAATGTCAGTGGAGTCTTCTGAGTGTTTCCTGGAAGAAGTCGGGTCCCAGGCTCTAGTTGCTGGTTCTTACATGCCACCATCCACAGTCCTTCAGCAGATTGATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCAGAGCAGCAAACACATGAAAGTCAGAAGTCTCTAATATATCATTTGTCTTTTTTCCAGTGAGGTAAAATAAGGCATAAATGCAGGTAATTATTCCCAGCTGACCTAAAGTCAATAAAACATTCTGTTTAAGTGTTTTTCTTACGTTTTTCTCAATGAGTTAATCAACAAGTATTTATTATGTGCTGATATCTTTGTTTTAGATGCTTTAAAGGAGACAGGAATATAATTATTGAGTATAGAAGCATCAGAAACTATTAAAATTAAGGCTAAGTGGCTATCGGGGTAAATAGTGCCAGATTACTATTGGTGGCGTTTAAGATGAAAGCAAGTTCAAAATTTGTCATTTTGGGTGTCAACAGCTAAATGGTCTGGTTTTTACCCCTGTTTTGCCTTTTTTGCAATAAAATTATTTCCAAAAAACATACATTTCCT