Transcript asmbl_20271

Sequence
Transcript Sequence for observation asmbl_20271 of TGE0000583:
GGGTGCGGGGAGTGGCGGGGTAAGGATGGGAAGCCGAGCAGACGGCCCCAGAACAAGCGGTCATGTGACTGGGAAGATGGCCGTCTTTCCTTGGCACTCCAGGAATAGGAACTACAAAGCTGAATTTGCATCATGCCGACTGGAGGCTGTACCATTGGAGTTTGGGGACTATCACCCTCTGAAACCCATAACTGTCACAGAGTCAAAGACAAAGAAAGTGAACCGGAAAGGAAGCACTTCTTCCACGTCCTCCTCCTCCTCCAGCTCCGTGGTGGACCCGCTGAGCAGCGTCCTCGATGGGACTGACCCCCTCTCCATGTTTGCAGCCACTGCTGACCCCGCAGCCTTGGCAGCTGCCATGGACAGCTCCAGAAGGAAACGTGATAGAGATGATAACTCCGTTGTAGGATCGGATTTTGAGCCTTGGACCAACAAACGGGGAGAAATCCTTGCCCGGTACACCACTACCGAAAAGCTGTCTATTAATCTGTTTATGGGATCTGAAAAAGGCAAAGCTGGGACTGCCACATTGGCAATGTCAGAGAAGGTGCGGACCCGGCTGGAGGAGCTGGATGACTTTGAGGAGGGTTCCCAAAAGGAGCTGTTGAACTTGACTCAGCAGGATTACGTGAACCGCATAGAGGAGCTCAACCAATCGCTGAAGGATGCCTGGGCCTCAGACCAGAAAGTGAAGGCTCTAAAAATAGTCATCCAGTGTTCAAAGCTTCTTTCAGACACCAGTGTTATTCAGTTCTACCCAAGCAAATTTGTCCTTATCACCGACATACTTGATACATTTGGAAAGCTCGTGTACGAGCGCATCTTTTCCATGTGTGTGGATAGCCGCAGCGTCTTACCAGATCACTTTTCTCCAGAGAATGCAAATGACACGGCCAAGGAAACATGCCTAAATTGGTTTTTCAAGATTGCCTCCATCAGGGAACTCATTCCAAGATTTTACGTGGAGGCATCCATCCTGAAATGTAACAAATTCCTCTCCAAAACGGGAATTTCAGAGTGCCTGCCCCGGTTGACATGCATGATCAGAGGGATCGGAGACCCACTAGTGTCGGTGTATGCCCGTGCCTACCTGTGCCGGGTGGGAATGGAAGTGGCCCCACATCTCAAAGAAACCCTAAATAAGAACTTTTTTGACTTCCTCCTTACGTTCAAACAGATTCATGGGGATACGGTCCAGAACCAGCTGGTGGTCCAAGGAGTGGAGCTCCCATCTTACCTCCCCTTGTACCCGCCTGCCATGGACTGGATCTTCCAGTGCATCTCCTACCATGCCCCCGAGGCTCTGCTGACCGAGATGATGGAAAGGTGTAAGAAACTAGGAAACAATGCCTTGCTGTTGAATTCTGTGATGTCTGCCTTCCGGGCTGAGTTCATCGCCACAAGGTCTATGGATTTCATTGGCATGATTAAAGAGTGTGATGAATCTGGTTTCCCCAAGCATCTTCTTTTTCGATCACTGGGATTAAACTTGGCCTTGGCTGATCCTCCTGAGAGTGACCGACTTCAGATTCTCAACGAAGCTTGGAAAGTCATCACTAAGCTGAAGAACCCACAGGACTACATTAATTGTGCCGAAGTGTGGGTGGAATACACCTGCAAGCATTTCACGAAACGAGAGGTGAATACCGTTTTGGCAGATGTCATCAAGCACATGACTCCAGATCGTGCATTTGAAGATTCCTACCCCCAGCTTCAGTTAATAATTAAGAAAGTTATTGCCCACTTCCATGACTTCTCAGTTCTTTTCTCAGTGGAAAAATTTCTGCCGTTTCTGGACATGTTCCAAAAAGAGAGTGTGCGGGTGGAGGTTTGCAAATGCATCATGGACGCCTTTATCAAGCATCAACAAGAGCCCACCAAGGACCCGGTCATCTTGAATGCCCTTTTGCATGTTTGCAAGACCATGCATGACTCTGTGAATGCACTCACTCTTGAGGATGAGAAAAGAATGCTGTCATATTTGATTAATGGATTTATAAAAATGGTTTCCTTTGGCCGTGATTTTGAACAACAGCTGAGTTTTTATGTTGAGTCCAGGTCGATGTTTTGCAATCTGGAGCCTGTTCTTGTGCAGTTGATTCATAGTGTGAACCGGTTGGCAATGGAGACAAGAAAAGTAATGAAAGGAAATCATTCCAGAAAGACAGCTGCATTTGTCCGGGCCTGTGTTGCCTACTGCTTCATCACCATCCCCTCCCTGGCGGGCATCTTCACACGTCTCAATCTCTACCTGCATTCTGGTCAGGTGGCCTTGGCCAACCAGTGCCTCTCCCAAGCTGATGCTTTTTTCAAAGCCGCTATAAGCCTTGTTCCGGAAGTTCCAAAGATGATTAATATTGATGGGAAGATGCGGCCATCGGAATCGTTCCTTCTGGAATTCCTCTGCAATTTCTTTTCTACTTTATTAATAGTTCCGGATCATCCTGAACATGGGGTCCTGTTTCTTGTTCGAGAGCTTCTCAACGTGATCCAGGACTACACCTGGGAGGACAACAGCGATGAGAAAATCCGCATCTACACCTGCGTCCTGCATCTCCTCTCCGCCATGAGCCAGGAGACGTACCTTTACCACATAGACAAAGTGGACTCCAACGACAGCCTCTACGGGGGAGACTCCAAGTTCCTGGCAGAAAACAACAAGCTGTGTGAGACGGTGATGGCTCAGATCCTAGAGCATCTGAAAACCCTGGCCAAGGACGAGGCCCTGAAGCGCCAGAGCTCGTTGGGCCTTTCCTTCTTTAACAGCATCTTGGCCCATGGGGACCTACGCAACAACAAGCTCAACCAGCTCTCCGTCAACCTGTGGCACCTGGCACAGAGGCACGGCTGTGCAGACACCAGGACCATGGTGAAAACGCTAGAATACATCAAGAAGCAAAGCAAACAACCAGACATGACTCATCTGACGGAGCTGGCCCTCAGACTCCCTCTGCAAACAAGGACCTGACCCCCGGGCCCATCCCCAGGCTCAGGGACTCTGGTGCCAAATCCAGAAAGATCTGCTCTGCTGCCCTGAACTCTTACGGCAATTTAGGTTTCTCATTTTTCTTTTCTTTTTACATATGTACAAATTGTTTTAAGCTTTGGCCTCTATCCAGGTTATTCTGACAATGAAGAAATGGGAGTTGTCAGAGCATTAAAATGCAATCTTCACTAAGAAGCAGTCTCTGTGTTGTCTTTGCACAAGTGGCCTTCGGTCTACTCAGCCCGATCTGATGGGCCTTTTTAGCAAGAGAGAAACAAGAATG