Transcript asmbl_10980

Sequence
Transcript Sequence for observation asmbl_10980 of TGE0000058:
CCCGTCCCCTTCCTTTCCAGCCTCACGCCCGTGGGCTGCAGTTGGAACGATGGCGGCGGCAGCTGCCGCCGGGCCTAGCCCGGGGTCTGGACCTGGGGACTCCCCAGAAGGGCCCGAGGGGGAGGCTCCGGAGCGTCGGCGGAAGGCGCACGGGATGCTGAAGCTTTACTACGGCCTCTCGGAAGGGGAGGCGGCGGGACGCCCCGCGGGGCCCGACCCCCTGGACCCGACTGATCTGAACGGGGCGCACTTCGACCCGGAAGTTTACCTAGACAAGCTGCGTAGAGAGTGCCCTCTGGCCCAGTTGATGGACAGTGAGACGGACATGGTGCGGCAGATCCGGGCTCTAGACAGCGACATGCAGACCCTGGTCTATGAGAACTACAACAAGTTCATCTCAGCCACAGACACCATCCGGAAGATGAAGAACGATTTCCGGAAGATGGAGGATGAGATGGACCGGCTGGCCACCAACATGGCAGTGATCACCGACTTCAGCGCTCGCATCAGCGCCACGCTGCAGGACCGCCACGAGCGCATCACCAAGCTGGCAGGGGTCCACGCGCTGCTGCGGAAGCTGCAGTTCCTCTTTGAGCTGCCCTCGCGCCTCACCAAGTGCGTGGAACTGGGCGCCTATGGGCAGGCGGTGCGCTACCAGGGCCGCGCGCAGGCCGTGCTGCAGCAGTACCAACACCTGCCCTCGTTCCGCGCCATCCAGGACGACTGCCAGGTCATCACGGCCCGCCTGGCCCAGCAGCTGCGGCAGCGCTTTAGGGAGGGCGGCTCAGGCGCCCCGGAGCAGGCAGAGTGCGTGGAGCTGCTGCTGGCCCTGGGCGAGCCTGCGGAGGAGCTGTGCGAGGAGTTCCTGGCGCACGCCCGCGGCCGGCTGGAGAAGGAGCTGAGAAACCTGGAGGCCGAGCTGGGGCCCTCACCTCCGGCTCCCGACGTGTTAGAGTTCACCGACCATGGAGGCAGTGGCTTCGTGGGCGGCCTCTGCCAGGTGGCGGCGGCCTACCAGGAGCTGTTTGCGGCCCAGGGCCCAGCAGGTGCCGAGAAGCTGGCGGCCTTCGCCCGGCAGCTGGGCAGCCGCTATTTTGCGCTGGTGGAGCGGCGGCTGGCGCAGGAGCAGGGTGGTGGTGACAACTCACTGCTGGTGCGGGCGCTGGACCGCTTCCACCGGCGCTTGCGGGCTCCCGGGGCCCTGCTGGCCGCTGCCGGGCTCGCAGACGCTGCCACGGAGATCGTGGAACGAGTGGCCCGCGAGCGCCTGGGCCACCACCTGCAGGGTCTCCGGGCGGCCTTCCTGGGCTGCCTGACAGACGTCCGCCAGGCGCTGGCAGCACCTCGCGTGGCTGGGAAGGAGGGCCCTGGCCTGGCCGAGTTGCTGGCCAATGTGGCCAGCTCCATCCTGAGCCACATTAAGGCCTCTCTGGCAGCAGTGCACCTTTTCACCGCCAAAGAGGTGTCCTTCTCCAACAAGCCCTACTTCCGGGGTGAGTTCTGCAGTCAGGGTGTCCGTGAGGGCCTCATCGTGGGCTTCGTCCACTCTATGTGCCAGACGGCTCAGAGCTTCTGCGACAGCCCTGGGGAGAAGGGGGGTGCCACACCACCTGCCCTGCTCCTGCTGCTCTCCCGCCTCTGCCTGGACTACGAGACGGCCACCATCTCCTACATCCTCACTCTCACTGATGAACAGTTTCTGGTGCAGGATCAGTTCCCAGTGACGCCCGTGAGCACGCTGTGTGCAGAGGCCAGGGAAACGGCGCGGCGGCTGCTGACCCACTACGTGAAGGTGCAGGGCCTGGTCATATCACAGATGCTGCGCAAGAGCGTGGAGACTCGCGACTGGCTCAGCACTCTGGAGCCCCGGAATGTGCGGGCCGTCATGAAGCGGGTGGTGGAGGATACCACCGCCATCGACGTGCAGGTGGGGCTCCTGTACGAAGAGGGTGTTCGCAAGGCCCAGAGCAGCGACTCCAGCAAGAGGACTTTCTCCGTGTACAGCAGCTCTCGGCAGCAGGGCCGCTACGCCCCCAGCTATACCCCCAGTGCCCCGATGGACACCAACCTCTTGAGCAATATCCAGAAGCTATTCTCTGAACGTATTGATGTGTTCAGCCCTGTGGAGTTCAACAAGGTGTCGGTGCTGACCGGCATCATCAAGATCAGCCTGAAGACGCTGCTGGAGTGTGTGCGGCTGCGCACCTTTGGGCGCTTCGGGCTGCAGCAGGTGCAAGTGGACTGCCACTTTCTGCAGCTCTACCTGTGGCGTTTTGTGGCCGACGAAGAACTCGTGCACTTGCTGCTGGACGAAGTGGTGGCCTCTGCTGCCCTGCGCTGCCCAGACCCTGTGCCCATGGAGCCCAGTGTGGTTGAGGTCATCTGCGAGCGCGGCTAGGCGCAGCCGCTGCCATGCACCGGTCTGTCCCTGCACCCCATGGCACCCAGGATCTGGTCTCGGTGGTCCTTCCCCGCAGGCAGGTGTCAGGACCGGCCTAATAAACATGTGTGGCCTCCTCCTCTCGCT