Transcript asmbl_44519

Sequence
Transcript Sequence for observation asmbl_44519 of TGE0005699:
CCCAGCCTCACCTCAGGGCAGCTACGGCCTCTCCTACCGACTTGTCTGTCCATCGGTCCATCTGTCCGTCCATCTGGACAGGTGCTCATCATGGACCACCCAAGCATGCGCATCTTGTCGTCCTGCTGCAAGATGTCAGACATCCTGGCTGAGGGCATCACCATTGTTGAGGACATCAACAAGCGGCGAGAACCCATCCCTAGCCTGGAGGCCATTTATTTGTTGAGCCCCACAGAGAAGTCGGTGCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTCACCTACAAAGCAGCACATGTCTTCTTCACAGACACCTGCCCCGAGCCCCTGTTCAGTGAGCTGGGTCGCTCCCGTCTGGCAAAGGTGGTCAAGACGCTGAAAGAGATCCACCTTGCCTTCCTCCCCTACGAGGCCCAGGTGTTCTCCCTGGATGCCCCCCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGCGAACGGGCACGGCAGCTCGAGGCGCTGGCCCAGCAGATCGCCACACTTTGTGCCACGCTGCAGGAGTACCCAGCCATCCGCTACCGCAAGGGCCCAGAGGACACTGCCCAGCTGGCCCATGCGGTCCTGGCCAAGCTGAACGCCTTCAAGGCAGACACTCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGTTCACAGCTGCTGATCATGGACCGGGCAGCCGACCCTGTGTCCCCGCTGCTGCATGAGCTCACATTTCAGGCCATGGCCTATGACCGAGCAGGACACGTATAGGTACAAGACCACCGGGCTGAGCGAGGCCCATGAGAAGGCTGTGCTGTTGGATGAGGACGATGACCTGTGGGTGGAGCTGCGGCACATGCACATCGCGGATGTGTCTAAGAGGGTCACGGAGCTTCTGAAGACATTCTGTGAGAGCAAGAGGCTGACCACCGATCAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATGCTACACACCTGCATTTAGCTGATGACTGCATGAAGCACTTCAAGGGCTCGGTGGAGAAGCTGTGCGGTGTGGAGCAGGACTTGGCCATGGGCTCTGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATTGTGCCAGTGCTGCTGGACGCAGCGGTGCCCGCCTACGACAAGATCCGGGTCCTGTTGCTCTACATCCTCCTACGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAATGTGCAGGCACACAGCAGCCTCATCCGGAACTTTGAACAGCTGGGGGCCACCGTCACCAACCCCGGGGGCCCTGGGACCTCCAGCCGGCTGGAGCGGAGAGAGCGTTTGGAGCCCACCTATCAGCTGTCCCGCTGGACCCCAGTTATCAAGGATGTGATGGAGGATGCTGTGGAGGACCGGCTGGACCGCAAACTGTGGCCCTTTGTGTCTGACCCTGCCCCCACACCCAGCTCCCAGGCTGCTGTCAGTGCCCGCTTTGGCCACTGGCACAAGAACAAGGCTGGTGTGGAGGCGCGGGCAGGGCCCCGGCTTATCGTCTATGTCGTGG