Transcript asmbl_28673

Sequence
Transcript Sequence for observation asmbl_28673 of TGE0032880:
AAAAAGGTTTAGCGAGGTAGGTCCGGGTCCCGGAGGCTCCACCCTGAACTATATGGGCGATGAACCCTTGTGCAGTTACCTGCAGGCGCAGCGGGAAGCCACGCGTGCCCACGCCCCGCACATGGGAGCTTAGGAGATTGTGGGTGAGCAGTTTCATGTTGTCACAGCGGAGCGCGTGAGGCCGGAACCGGAAGGAGTCCACACTTCTCCTTTCTACCACTTCCGCTTTGAAGCCGTTGAACTCTTCGCCGGACCGGAAGTGGCCGACTTAGGGGACCTTTTGGGGGGCTTGGCGGCAGCCGAGATCGGAAGGACTGTGTTGGGTCACGTCCTGGTACCGGAAGCGTTTCTCGGGGAGACTGCAAAGGCTTACGCCGAATCCCGCTCGCTGAAGAGAGTACACACTATGCAAGTCACGTGTAAACCGGCTGCGTTACGGCGCAGGTAAAACGAACACATTTGAGGCTCAGCCAGATCATCCCCGACCTCTGTTTGCGGCTATGGGTCACGAACTGTCACGTCGGTAAACCAGGCACCTCTTTCTGCGATTGAAGAAGGTGTGCGAGCCCTGAGAGCCCCGCCGCGTCGTAGTGCGTCACGGCCCTGCCCCTCTAAGCCGGCGCTGTGGCTGCGACGTGGGACGTGCGGCGTGGGCGGAGCTGTCCCTGCATCCACCTCCTGTGGGCAGAGCCATCTGCGGGTGGGCTGCGGCAGCGGGGCGGGTATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGGCAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGTGACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAGAAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACACCTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCAGGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAAGGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATTCTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAAGGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTCTGAGGCCCTGGCCAGATGTCCTCTGACTCTCCCATCTCTCCCACCCGGCTCTAGGCCAAAAGGCTCGGTACCTCCTTACTGGGAGCCACGTAAATGGAACCTTGACCATATTTCTGCAATAAACAGTTTAATTTGTGTCTTTA