Transcript asmbl_44256

Sequence
Transcript Sequence for observation asmbl_44256 of TGE0005674:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTGTCGAAACAACAGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGAAACCAGACACCCTGCAGTGTCCCATCGTGTTGTGTGGATGGCGGGGAAAGGCCTCAATTCGAACTTTCGTGCCCAAGAATGAGCGGCTGCATTACCTCAGGATGATGGGGCTGGAGGTGCTGGCAGAGAAGAAGAAGGAAGGGCCTGTCCTGACAGGCGACAGTGCCTCTGGCTCCGGGCCACCGGAGGACGAGGCGAGTGCCGACCGGGACGAAGAGCAGGCTGCCAGTGTGGACGGCGCAGGCGGTGACCCGGCCGGGGGTCCTGGGGCGTCTGCACCCCAGTCCAGAACTGCTGACCTGTAAAGCACGATTTTAACGGCTGGAAACAGACGGGATGGTAGAAGCTTCTGCGAGTGACCGCCGTCCTGCTGTCGCACGGCGTGTGAGGAAAGTATGTTTTCAGCTTGTTCGTTGCTCCTTTTACTTTGTTCTCTGGCGAAGCTGGGCCCAGCGCCTGCTGCCGGTGGGAGGCTTCGTGGTCGAGGTCTCGCTTCCATCAAGAAATGTCACTGCCCACGCAGAAACGTTCAGGTCCCTTCATTACACCTGCATTGGTCTTAAAGTCCAGTATTTCTTTTAATTATTATTTATAGGGAGGATCTGTATGTCCTTACGAGTCGTTGGAAACCATGCTGTAAGCTTTAATAATTGTATTAAGTTGCGTATCAGTGCGACATCGGTGCACAGTGGGTTAATATCCGGGCTGTCAGACGGCTTCTGTGCCTTTATAACAAAGAGTGAAATGTATCCTGTCATGTCAGAGAGACCTGCGTCATGAACTGTGAGGCTCATGAGGGTTTTATGTGCTTTTAGGAAACGAAGCACTTTGCAGTTTTAATTTTTTAATGGGGTTTGGGATGCCTGGAACGTTTAATTAAAGAGACTAATGAAATGTG