Transcript asmbl_44245

Sequence
Transcript Sequence for observation asmbl_44245 of TGE0005670:
ATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCCTGTGGAGAAG