Transcript asmbl_44242

Sequence
Transcript Sequence for observation asmbl_44242 of TGE0005668:
GGAACAGTTACCTCGGGACTCACGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGCGCAGAGATGATGGGGAACATGGAGCTGGCCCCAGAAGTGGACGTCAGCGCCCTGGAGCCTTTGCTGTCTCCACACGTGGTCTCTGAGCTGCTGGACACGTACATGTCGACTCTCACTTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCTTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGGAGCAACATCTCAGTGAGCTGATGACAAAAAAGTGGCTGTCGGGATCGAAGGCTGTAGACATCATCTGCGTCACCGTGGAAGACTATTTCAATGATTTTGCCAAAATCAAAAAGCCATATAAAAAGAGGCTGACGGCCGAGGCGCACCGGCGCGTGGTGGTGGAGTACCTGCGGGCCGTCATGGCGAAGCGCATCTCCTTCCGGAGCCCCGAGGAGCGCAAGGAGGGCGCCGAGCGGATGGTCAGGGAGGCTGAGCAGCTCCGCTTCCTGTTCCGGAAGCTGGCTTCCGGGCTCGGCGAAGAGGCGGATGGGTACTGCGACACGATCACGGCCGTCGCAGAGGTGATAAAGCTGACGGACCCGTCCCTGCTGTACCTGGAGGTCTCGACTCTGGTCAGCAAGTACCCGGACATCAGGGACGAGCACATCGGCGCGCTGCTTGCCATGCGAGGGGACGCCAGTCGGGACATGAAGCAGACCATCATCGAGACGCTGGAGCAGGGCACCACACAGGCGAGTCCGAACTACGTGCCCATCTTCAGGGACATTACGGTCCACAGTCTGAACGTCACCAAGCTCCTCAAATAACTTGTCTCGCCCCGAGTCTGCCCCACCCTCAGCAGTGCGTGACTCTGGAGGCCCAGCGCTCTGGTGGCAGGCCCTGGCCCTGGCCCTGGCCCCCCCCCGGGTCAAGAACGACGTTGCGAGCAGACCCAGGTGCCTGTGCCCCGCGCGCGTCGGCGCTTGTGTAGCTGCTGCTCAATAAAGGCACCGTGGAGCGAG