Transcript asmbl_26648

Sequence
Transcript Sequence for observation asmbl_26648 of TGE0002143:
TCCGCCCGCCGCCTTCCACTCCGCCCCTGGCGGAGGAAGTGAGATCAGAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACGAGCATGATATCGCTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGACGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTCGGAGCCATCACATCTGTACAACAGAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTTTACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTTAACATTGACTTTGAACCTTTCAAACCAATTAATACATCATTGTATTTGTGCGACAATAAGTTTCATACAGAGGCTCTTACAGCGTTACTTTCAGATGACAGCAAGTTTGGTTTTATTGTAATAGACGGAAGTGGTGCTCTTTTTGGCACGCTCCAAGGAAACACCAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGCAGAGGAGGTCAATCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGAGACATAACTATGTTCGGAAAGTAGCCGAGACTGCTGTGCAGCTGTTTATTTCTGGAGACAAAGTGAATGTGGCTGGTTTGGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGACATGTTTGACCAGAGGTTGCAATCTAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAATTATCTACTGAAGTTCTCTCCAACGTGAAGTTCATTCAAGAGAAGAAATTAATAGGACGATATTTTGATGAAATTAGCCAGGACACAGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATACGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATTTAACTCCAGAACAAGAGAAGGATAAATCTCACTTCACAGACAAAGAGACTGGACAGGAACACGAACTGATAGAAAGCATGCCTCTCTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACACTAGAAATTGTCACAGATAAGTCACAAGAAGGATCACAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAGTACCAAGGAGGAGATGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAACCGTGCCTCACCCTCCAGCATTCAACCCAAGGAGCATACCCGTGGTGGAGTCCAACAGATCCCTGCCTTACAATTGGAGCATTTCCAGAACTTAATCCGTGAGCATTGGATACTGAAAAGAAAAGTGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCGTGGTGTCAGCGCAGCAGCCGACAACTAAGTCTCTAAAGGCCACTGTGGACTCATTTAAAAAGAATCCCAGTTTTTACTTTTACTTGATGGTAAAATTGGTTGCTCTTGTATTTTATGAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAGTAGACGTGAGGTCATACTGGTTTGTTTCTTCCTTTGATCGGAGAATAACTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCGGCTTAGACTGCACAAGAAGAAATATATGTGAAATATTGGAACTGTTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTGACAGGAGGCAGTTTGAGCTTCACTCCCTCACACTCCCCACTCCCAGACTGTCCCTTTCAAAGGTGCAGGTTGCGTTGTAAAGTCAGACTGAGTGCCAACACACTGGGGCCAGGGCACTCTGGGCAGTCACCAGTGTGGAGGCACAGTTGTGCCTGGCATTTGGGAGCCCTCTGTGCCATTAGCGTTACTGAGGCTCCCTGTCATCTCAGCCTACTAGAAACCAGTCTGGGATGGACATGATGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAACTTAAGTGGAACCAAAAAAAAATTCAAAGATGATTTTGCTTGGATCTATTCTTGGTAAGGGGAGGCGGTGGTGTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTATTTTTTTGTTTTCAAATGAACTGCAAGATTTTTTTCACGGGAACGACAGACACGACACGTATGACCGTGCATGTATCTCAAACCCCTGGTGGGGCTGGAGCATCTATTTCAAAAAGTGGGATCTACAAGCACCTCTCAGATGAGAAAGTATGGAGGCG