Transcript asmbl_23146

Sequence
Transcript Sequence for observation asmbl_23146 of TGE0039714:
GGGCAGCAGCCATGCGGCGCGATGTTCGCATCCTGCTGCTGGGCGAGGCCCAGGTGGGGAAGACGTCTCTGATCCTGTCGCTGGTCGGCGAGGAGTTTCCCGAGGAGGTCCCTGCCCGCGCGGAGGAGATAACCATCCCCGCCGACGTCACCCCGGAGAAGGTGCCCACTCATATCGTGGATTACTCAGAAGCGGAGCAGACAGAGGAAGAACTTCAGGAGGAGATCCACAAGGCAAATGTAGTGTGTGTGGTGTACGATGTGTCTGAGGAGACCACCATTGAGAAGATCCGAACCAAGTGGATCCCGCTTGTGAATGGCAGGACGGCGACAGGGCCCAGGTTGCCCATCATCCTGGTGGGCAATAAGTCTGACCTGCGGCCGGGGAGTACCATGGAGGCTGTGCTGCCCATCATGAGCCAGTTTCCTGAGATAGAGACCTGCGTGGAGTGTTCAGCCAAGCACTTGAGGAATATCTCAGAGCTGTTCTACTATGCCCAGAAGGCTGTTCTGCATCCCACAGCCCCCCTTTATGACCCTGAGGCCAAACAGCTCAGGCCTGCATGCGCCCAGGCGCTCACACGCATCTTCAGGCTGTCGGACCAGGACCGAGACCACGGGCTGAGCGACGAGGAACTCAATGCCTTCCAGAAGTCCTGCTTTGGCCATCCCCTGGCCCCACAGGCCCTGGAGGATGTGAAGAGGGTGGTGTGCAAGAACGTGTCAGGTGGTGTGCAGAATGACCGGCTGACCCTGGAAGGCTTCCTCTTCCTGAACACACTCTTCATCCAGCGTGGCCGGCACGAGACCACGTGGACCATCCTGCGGCGCTTTGGTTACAGTGACTCACTGGAGCTAACGCCCGACTACCTCTATCCAGCGCTCCATGTCCCCCCTGGCTGCAGCACAGAGCTCAACCATCGTGGCTACCAGTTTGTGCAGCGGATGTTCGAGAAGCATGACCAGGTAAGCACGTCACCTCACGCCTTGACACCCCTCCCCGCAAAGAAA