Transcript asmbl_22905

Sequence
Transcript Sequence for observation asmbl_22905 of TGE0032507:
CGAGCGGGTGTGACCCCGGCGTCTGGGTTCGGTTCTGAAGTCCGGGCTTGGTCCGGGTGATCCCCAAACACTGACCGTTCTCATTTCCTTTTGGGAGTATTCATGCTTCACCATGTTGAGAGCTAAGAATCAACTTTTTTTGCTATCGCCCCATTACCTGAAGCAGCTAAACATTCCATCAGCTTCCAGATGGAAACGCCTTCTACACCAGCAGCAACCCCTTCACCCAGAATGGGCTGTACTGGCCAAAAAGCAGCTGAAAGGCAAAAACCCAGAGGACCTTATATGGCACACCCCAGAAGGGATCTCTATAAAGCCCTTATATTCCAGGGCAGATACTCTGGACTTACCCGAAGAACTTCCAGGAGTGAAGCCATTCACACGGGGACCATATCCTACCATGTATACCTATAGGCCCTGGACCATCCGTCAGTATGCAGGCTTTAGTACTGTGGAAGAAAGCAATAAATTCTATAAGGACAATATTAAGGCTGGTCAGCAGGGGTTGTCTGTTGCCTTTGACTTGGCAACACATCGTGGTTATGATTCAGACAACCCCAGAGTTCGTGGAGATGTTGGAATGGCTGGAGTTGCTATTGACACTGTAGAAGACACCAAAATCCTATTTGATGGCATTCCTTTAGAAAAAATGTCCGTTTCCATGACTATGAACGGAGCTGTCATCCCAGTCCTGGCAACATTTATAGTAACTGGGGAAGAGCAAGGTGTGCCGAAGGAGAAGCTCACTGGCACAATTCAGAATGACATCCTAAAGGAGTTTATGGTCAGAAATACTTATATTTTTCCCCCAGAGCCATCGATGAAAATTATTGCTGACATTTTCCAATACACAGCACAGCACATGCCAAAATTTAATTCCATTTCGATTAGCGGGTACCATATGCAGGAAGCAGGAGCTGATGCCATTTTAGAACTGGCCTATACCATCGCAGATGGGTTGGAGTACTGCAGAACTGGACTCCAGGCTGGACTCACAATTGATGAATTTGCACCAAGGTTGTCTTTCTTCTGGGGAATTGGAATGAACTTCTACATGGAAATAGCCAAGATGCGAGCTGGGAGAAGACTGTGGGCTCACTTAATAGAAAAAATGTTCCAGCCTAAAAACTCTAAATCTCTTCTTCTAAGAGCACACTGCCAGACATCGGGGTGGTCACTTACTGAGCAGGATCCTTACAATAACATTGTCCGCACTGCAATCGAAGCCATGGCAGCTGTGTTTGGAGGAACCCAGTCTTTGCATACGAACTCTTTTGATGAAGCGCTGGGTTTGCCCACTGTGAAAAGTGCCCGGATTGCTCGGAACACACAGATCATCATTCAGGAAGAATCTGGGATCCCCAAAGTGGCGGATCCTTGGGGAGGGTCGTACATGATGGAGTCGCTCACAAATGACGTTTATGAGGCTGCTCTGAAGTTGATATATGAAGTTGAAGAAATGGGTGGAATGGCCAAAGCTGTAGCTGAAGGAATCCCTAAACTTCGCATTGAAGAATGTGCTGCCCGAAGACAAGCTAGAATAGATTCTGGTTCTGAGGTAATTGTTGGAGTAAATAAGTATCAGTTGGAAAAAGAAGACTCTGTGGAGGTCCTGGCCATTGACAACACTTCAGTGCGTAAGAAGCAGATTGAAAAACTCAAGAAGATTAAATCCAGCAGGGATCAAGCTTTGGCTGAGCAGTGTCTCAGTGCACTTACCCAGTGTGCTGCCAGTGGAGATGGCAATATTCTGGCTCTGGCAGTGGATGCAGCTCGTGCAAGATGTACAGTTGGAGAAATCACGGATGCCTTGAAAAAAGTATTTGGTGAGCATAAAGCTAATGATCGTATGGTGAGTGGAGCATATCGGCAGGAGTTTGGAGAAAGTAAAGAGATCACATCTGCCATCAAGAGAGTTAATAAATTCATGGAACGTGAAGGTCGCAGACCTCGTCTTCTTGTGGCAAAAATGGGACAAGATGGCCATGACAGGGGAGCCAAGGTCATTGCTACAGGATTTGCTGATCTTGGTTTTGATGTGGACATAGGCCCTCTTTTTCAGACTCCCCGTGAAGTGGCGCAGCAAGCTGTGGATGCAGATGTCCATGCTGTGGGTGTCAGCACACTTGCTGCTGGTCATAAAACCCTCGTTCCTGAGCTTATCAAAGAACTCACCGCCCTGGGGCGGCCAGATATCCTTGTCATGTGTGGGGGCGTGATTCCACCACAGGATTATGAATTTCTGTATGAAGTTGGTGTTTCCAACGTCTTTGGTCCTGGAACCCGGATTCCAAGAGCTGCTGTCCAAGTGCTTGATGATATTGAGAAGTGTTTGGCAGAGAAGCAGCAGTCTGTGTAACATCTGGATCTTTAGTTATGACTGAAG