Transcript asmbl_20834

Sequence
Transcript Sequence for observation asmbl_20834 of TGE0031446:
TCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAATTAAAACGTATAAATTGTCCTAGTCCTGTGAGAGCCCCCATTTTAATTGTCCATGCATGCAGGGAGTTTTGTTGAAAGCTAAGCAGGAAATGGGTATTGTAGGTATGACTTTAGGGATTGATTGCACCTCAACAGTTAAACCCATAGGTTTCTCAGGGTGGATTATATCTGTACCCATTTAAAATTTGGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTAAACATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCACTGCTATATTGGCTTTGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAGTGCCTTGTGGGAAAAAATACCAATATTTGCCCTTAAAAGCATTTCACTACACAGTGGAGAATGTAGAAATTGATTATTTACGTTCCTAGTTGGTGTTTGAGGTAACAAGGTCCCAAGTTTAAAAAGAGGAGGGAGCATTAAGTTTAAGGTGAATTTTAAGCTTGAAATTAGTAAATTTTGTGCTATGCATGCATAAAAGCTGTTGGCATATATAATAGTGCAATTATGCCTTTAAGCTTAGTCTTAGACCTAGGTTTTATAGAATAACTACCATTTTTGGCTTTTAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCCAAGGCATTTTGTATGTTAGCATTTCTGATAGGGAGTGATAGGTGGTTTGTATTGTCTGGTACTTTGTAGGAAGGTAGAGAGCTGTTTTGGAGGTAACACGTTTGAGTAATTTGAGTATATAACGTGTGAAAAGAAGCTGAGCAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTTGCTTTCACACTGGAAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGCATTTGTATTTACAGTTCCAGAAGTGCGTCGAAATGGATTGTATAACTGTTTTCTTTTATTCCTGGTGTTTACATTTGTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACCCCAAACACAATACTGTCATCTGCTTTATTGTAATGCTCAAGGCGCCTATCTCATTTTGCAGCCAGACAAGCCTTGAATTCTTTTGGTGGCACTATCTGCAAAGGAAGATGTTTTTCCACCTGGATATTGGTTTTATCAGCTAGTGCTCCACTTAAAAGCACGAACTATAATCCTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTAAATAGTACTAAAGTAACTTGCTGACTGTTGGTTTCTTTCTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTT