Transcript asmbl_20472

Sequence
Transcript Sequence for observation asmbl_20472 of TGE0032373:
CGGAAACCCTCGCGGTGCAGTGCAGGCCGCGGTGTGCACGCGGATCTGCTCCGGAGTCCTGCAGCCCAGCCGCCGGCCGCAGTCTGGGTACCTGCGGAGCTTCTCTCTGCCGGTGCTGGGGTGCTGGGTGGACCCGCTGGCTTTCCAGGATGCGGGGCGTGGAACGTGGCCTCTGAGAACCCCAGGCGAGAGGAAGCCGTGCTGTAGGAGTCGTTAGGCACGGCGCTACCTGAAGCGGAAGCCGCGTTCACCCAGATCGTCTCCTGTGTCGCGCTTTAAAGTGGTTCCTCACATTTCTTCAAAATGAATGTGACTGTCCGTTTCTTAAGACCTTTTGCCAGATGTCTGGTGCCATATACCTTTCATAGGAAGAGAAGTCATTTATATTCAGGAGTTCTGCAGAGATACATGTCCTCCAAAGCACCTTCTTTGTCTTGTCATAATAAGGACAGTGCATCCCCTCCTGAGCAGCTAGAATTGGATGGGTGGAAAGCTACAATGAAGTCGAGCATTCAAGAAGATGGTGTTTCAGAGGTCTCAGACAAAGATGAAGATTCCCTCGCCTCAACCAGAGAACTAATTGAGATGTGGAGATTGCTTGGCAAAGAAGTACCAGAACATATTACTGAAGAAGATCTCAAAACCCTTATGGAATGTGCCTCTAAATCAGCCAAGAAGAAATACTTACGGTATCTGTATGGGAAGGAAAAGGCGAAAAAAGCTAAGCAGGTAAAGAAGGAGATGAAAGCGGAGGCCAGGGAAGAAGCAAAAAGGGCCAGGTTGCTAGAGACCACCGCAGAAGAACAACAGCAAGACTTCATGTTTCTTCGACTATGGGATCGACAGATCAACATTGCACTGGGTTGGAAGGGTGTCCAGGCTATGCAGTTTGGACAGCCTTTGGTTTTTGACATGGCCTATGATAATTACATGAAACCAAGTGAACTGCAGAATACTGTTTCTCAACTTTTAGAAAGTGAAGGATGGAACAGAAGAAATGTTGATCCTTTCCACATTTATTTCTGCAATCTTAAAATAGATAGTGCTTATCATAGAGAATTAGTTAAACGTTATAGAGAAAAATGGGACAAATTGCTCTTAACAGCAACAGAAAAGTCTCCTGTTGATTTATTTCCAAAGGACAGTATTATATATTTAACTGCAGATTCTCCCAATGTTATGACTACCTTCAAGCATGATAAAATTTATATAATTGGATCATTTGTTGATAAAAATACACAGACAGGAACATCCTTAGCCAAGGCCAAACGGTTAAACATAGCAACAGAGTGCCTTCCACTAGATAAATATTTACAATGGGAAATTGGTAACAAAAATCTCACCTTAGATCAGATGATCCGAATTTTGCTCTGCCTGAAAAACACTGGTAACTGGGAAGAGGCTCTCAAGTTTGTTCCCAGGAGAAAGCATACTGGTTATTTAGAGGTTTCTGAGCAATCTCAGGAACTTGTTAGGAAACTGAAGAAGACAAAGACTTTAAATTCATTTCGAAAAGGCTCCTTAAATGTGCGCACGTGGAAAAGGTGACCTAAGTGAGAAAGTATGGTGAAAGAAGAAAACAGGCTGAAAGTATGGTGACAAGAATGTAGTTATTCCTAAATGGAATTATCTCTTAAAGTCAGTCTCTCTAGACTAACAGTAGAGGTTTGCCTATTTTTTCTTCTTCTTTGCTTTTTTGCAACAGGATTTCCATGTAGCCTTGTCCTCCATCAAGGCCAGACTAGACGTATGTATCAGCAAAACTTTGAAAGTATGTTTTATTTGTTGTAAAAACAATCAAGTTTATAATTAATCTAGAATTGAAC