Transcript asmbl_19594

Sequence
Transcript Sequence for observation asmbl_19594 of TGE0032292:
CGTGACCCGACCGGCCTCCGCGCGCAGCGTGGATCGCGGCCGGAGCCGCCATTGTTCCGCCGGGGGAGGACAGCGGGTCCTGGCGCTGGCGCCCCGACGCCGCTTAGCGGCCGCCTCTGGAGACACTCTGTCCCCGCCGCCCCGTGTCCTCCTGGTGGCGGCGGCGTGAGGCCGGCTGCGGAGACTGGGAACCTTTGGCTCTCCCCGTGGCGGCGGCGGCCCTCTATCCCCTACTCCGGCGTGAGGGTTGGCCGCGATGCGCTCGGCCTGAGGTGTCGCGGCCCTGTCGCCTCCCACGACTGTTCCAGCGGCGGCTCCGCTCCCCGGCGTCATCCCGCGAGTCTCTCTGACGGGAGGGAAGATGGCTGCACGAAGCTGGCAGGACGAGCTGGCCCAGCAGGCCGAGGAGGGCTCTGCCCGGCTGCGGGAGTTGCTCTCGGTCGGCCTAGGTTTTCTGCGCACGGAGTTGGGCCTCGACCTGGGGCTAGAGCCGAAGCGGTACCCGGGCTGGGTGATCCTGGTGGGCACCGGCGCTCTCGGGCTGCTCCTGCTCTTCCTTCTAGGTTACGGCTGGGCCGCGGCTTGCGCCGGCGCCCGCAAGAAGCGAAGGAGCCCGCCCCGCAAACGGGAGGAGGCGGCCCCGCCGACTCCGGCCCCCGACGACCTAGCCCAGCTGAAGAATCTCAGAAGCGAGGAGCAAAAGAAGAAGAACCGGAAGAAGCTTCCTGAAAAGCCCAAACCAAATGGACGGACTGTTGAAGTACCCGAGGATGAAGTTGTTAGAAATCCCCGAAGTATAACTGCAAAACAAGCACCAGAGACAGACAAGAAAAATGAAAAGTCAAAGAAAAATAAGAAGAAATCAAAGTCAGATGCTAAAGCAGTGCAAAACAGTTCACGCCATGATGGAAAGGAAGTTGATGAAGGAGCCTGGGAAACTAAAATTAGTCACAGAGAGAAACGACAACAGCGTAAACGTGATAAAGTGCTGACTGATTCTGGTTCATTGGATTCAACTATCCCTGGGATAGAAAATATCATCACAGTTACCACCGAGCAACTTACAACTGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAGTCTGGAAAAGGAGATTCTACACTGCAGGTTTCTTCAAGGCTGAATGAAAATCTTACTGTCAATGGAGGAGGCTGGAGTGAAAAGTCTGTAAAACTCTCCTCACAATTGAGTGAGGAGAAGTGGAACTCTGTCCCACCTGCTTCTGCAGGCAAGAGGAAAACAGAGCCATCGGCTTGGACTCAAGACACTGGTGACACTAATGCAAATGGGAAAGACTGGGGAAGGAATTGGAGTGATCGCTCAATATTTTCTGGCATTGGATCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCTTATATCGATGATGAATGGTCTGGGTTAAATGGTTTGTCTTCTGCTGACCCTAGCTCAGACTGGAATGCACCAGCAGAGGAGTGGGGGAACTGGGTAGATGAAGATAGAGCTTCACTTCTGAAGTCCCAGGAACCAATTTCTAATGATCAAAAGGTTTCAGATGATGATAAAGAAAAAGGGGAGGGAGCTCTTCCAACTGGAAAATCTAAAAAGAAAAAGAAGAAAAAGAAGAAGCAAGGGGAAGATAACTCTCACACACAGGACACAGAAGACCTAGAAAAGGACACTAGAGAAGAGCTTCCAGTGAATACCTCAAAAGCCCGACCAAAACAGGAGAAAGCTTGTTCCCTGAAGACCATGAGCACTAGTGACCCAGCTGAAGTACTCATCAAAAATAGCCAGCCTGTCAAGACTCTTCCTCCTGCTATCTCTGCCGAGCCATCTATTACCTTATCAAAAGGTGACTCTGACAACAGCTCTTCCCAAGTGCCACCGATGTTACAAGACACAGACAAGCCCAAGTCAAATGCTAAGCAAAACAGTGTGCCTCCCTCACAGACCAAGTCTGAAACTAACTGGGAATCTCCAAAACAAATAAAAAAGAAGAAAAAGGCCAGACGGGAAACGTGAATTTTTTTTTCCTGAATTGGACATGTGTTTACAAACACTGTCTTGAAGATTATGCTGTTTATGCAATAATTTGTGAACATGTACAGAGTTTTATATAAATTTAAACCAATTTTTAAAACAAAACTGAACACAACCACCATAAAATGGAATCAAAGGAAAGTTAATTTATGAAATAAAGAGGTCAACAGAATACACAGTGCTGGAAGACACTTGGGAGAGTCTTTTCAATTGAACGAGAATGATCGTAATTTAAGACTATTATCCTGGTTTTACAACAGTTACCTGTTTACAACAGACTGTGCCCTGTCTCCTCTGCAGCTGAGGAATAATGAATGGATTCTGATTAGAGAGAAGGCTGCCGTGAGGCCAGTAGGCAAGTCCTTGGATCTTATGCACGACCTTAGACCATTTGAATCTGTTTTATGCTTAAATCAAAGTGCTTTGATCAAATGTATAATCTGCCATATCTTTACATATTTGTTGTAGCAGTTTGTATTAAAAGAATCACAAGTGCAAATTAAAAGGTCATTTATCATTTATTTAACTAAACTGTCTTGGTTTAGTTTACAGTTCTTTAAAAGTTCTAAATTAAAACATTAAAAAATGCAATTGACAGACACTTGTATGACTTACAAAGTTATTTTTGATAGTCTTAACATTACTTGAATTATTCAAAATAACAGTATATTTTAAATTAAGAAAGGTAAATATATTATTTGTTTGATACATTAAGACTGAGACTAACAATGCTCTTGTTTATGATTTGAAAAGTTTTCAGGCAAATCCAACTTAGTGTTTTTCCTTTCCCTAGCAATTTTCCAGTGTCAACTCTTAGTTGCTAGTAATTTTTTTACCTTAAAAATGAAGTAATTCGCAACTTTTGAGCATATGACGGAGAATGCAAAAGTAGTCAGACAGCTTTAATTGATATTGTGGAGACCTCCGGTTATCAGGAATACATTTTTTTACTGCCTTAACCTCCTGTAGTGAGTAGAATATGCATCAGTTTCTTGAAGGGGATTCGTGTTTTTATAAGAATTTTCATGTAACTATTGCAATTGTGGTTAAAAACAGAAAGGAACATTTTCTGCTTGAAACTGTGTTGATTTGAATGACGTATGATCTGTCACCATTTTCAGGCACTGTGTGATCCCTAGGAAAGTGGCAGGCCTCTCTGTAACTGTTAATAGTGCATGCTCGGCCATGTACACTGTAAATAGCCTTTACCAAACGTGTTTGACAAGGACCATAATTAACATCACTTTAGTAAATTGTGATTTTTTTAAAAAAAGCCATGATTTATTGATGTGAGTGGCTTGTTTTCATGTGGCGCCAGAAATGAACCTGTTTAAAAGCTATAACCAATGGTACTGATCTATCCATTAAATACTGTCCTTAAACTGTAGTTTAATAGTATTGTCAACTAGGAAAGCTAAAATGGTTTTTGTTCTGTTGAAGACTGGCCTTATTAATGGACAGCTTTCCTCAGAAGTGATTAACAACTTTTTTATTGGGTGTTAACATCTGTTTCAAGAACATGGCAGTATGTTTACATGTCGTCAGAAGTTTTCTTTGAATGGAATTTCTAAATTAATTTACTTGTTTAAATAAATTCAGAACTGGGTAGCATTGTTTTTATTTGCTTCACTATTGAGGTGAATAAGAGCTGATGTGCCACAAATGGAGCCTTCAGATGGCTGCTTTGAGCTTCGTGTTCCCTCAGGGGATGCCAAGATATGTCTCAAGGAGAGATTAATGAGGGGTTTGTAATTACAGAGTGTGCCAAGGTCAGTGCTCACAAGTTTAATTGAACTCTCTCAACTCTACCTCACTGTTCCTTTTCCTTATAATTCTCTGGGCTAGGTCAAATCAGAAACTTTATTTTTCGGTTCAGTATCTCCCGATTCAATCACTTGTAGGAGGTGGTAACTACACTTAGCAGTAAGAATATCACCTTTTTGAAGAGATGTGTATTATGGGAGTGGAAGCACAGCGATACACTGGGTAGGTCAGTGTGGAAGTCGCCTCTGTGCCTTCCTTCTCGCTGGCTTGTGAGCCAGGCCCCCCTCCCCCCCAACCCCCACGCCGGTAGAAGGAGGCAGGTATATGAGTCAAAATCCAGTTCTCTTAAAATCGTTGCTCTTTACCTCTCTATAGATCTTTGTGTGGCAGGGCA