Transcript asmbl_19391

Sequence
Transcript Sequence for observation asmbl_19391 of TGE0000137:
GTGGGTGTTCGCCGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCCCTGTACACTGACACGGTCAGCCCCCAACTGCTGTCCTGATGATGAATCATTCCAATTTACTGGATTTAAAACAGAATGAAGCTGTTACGGTTTCGTGGGGTGGTCCCCATTGGTTTCAGGAGGAAGAGTGGGGTGTTCTCTGTTTGCTGTTTGGCACTGGTTGCTGTGCTCTTGGCATCTGAGTCCCTTCCCTGTGTCCCTGGCCACTCTCCTCCCTGTCTTCCTTTCCTTCTGAACCCTCTCCTATTCTACATGGACATTGCACGGGCCTCTCTGTGTGTGCGTGCATGTGTGCGCCTGTATATATGTGTATAGAGAGATATATATGTAGGGTCAGGGGAGGGAGCACAGCGCAGCTCAGGGCTTACAGCCGGGACACTGCGCACTGGAACCTGTCCCCTGCCCTTCTGTGTTGGTGAGATAAGGGGATGTGGGTGGGTCCCGTTGTTTTCCTCTCTGCAGGTGGCATTCCTGGATGTTGGGATACATGATGGGCGCCTTCGGCCATCTGTCTTACCTTTCCTTCTCCACTATGATGAGCACACGAAGTGGCATTGGTCTCTGGGTGACTGTTCCTAAGGAGCTGCCGTGCTACTCTGCCTCATTAGTAGCCCACTCACGCTATCAGTCTAGAGTGTTGTATTGATCCTCCCCCACCGTCCTCAGATCTGCTCCTCAGGAACTCAGAGGGAGGTGGGTTAGTGGGACCTGCATGTAGAGGTGGACAGTGGTCGGGGAAGGCCTAGTTTTCCATCTTACTGTCATAAGGAGGAGAAGGTAAGGCATGGAGCAGTCCTGTTCCTGCCTTCTGGTCTGTCAGAGATCTTTCCCCTTAGTAGTTCTGCTGGCCTGATGAGGACTGACCAAGTGGAGTAACGAGAAGCCATGGACTGGGGGTAACATAGCCGACCTCAGTATCAACTCCCTGTTCTTCAGTTCTCTGTCTAGTTCAGGACCAGGAAAGATGAGTTTCTGTTGTCCTCGATGTCCTGTCCCCCTCCTTCCTGGCAGCTTTCCCCAGTCCTCACCCTGTCCTGAATAGGTCTGTGGGGTTGGAGTAGATGCCGTAGGACCCTGCATGGCTGAGCCTGGAACTGTGATCTTCAGGGCCCTCCCTCCCTCCATCCTCTGCTTGTTCAGCTGCTGCTGCAGGTCTGTAGAGGGCGCCTATTCCAGAAGATCTGACCTGGGTCCTGACTTGTCACTGCACTGAAGCTGTGGCTGTTCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCAAAACAGCTGCCCATAACCTCTCTGCTAAGGTCAGGACCCTGGGCTCTCTGCAGCTTGGCCAAGGGACTCTTCCCAGAGGCCTGTTCTGAGTTCCTCCACTCAGTGGCCAGGTTTCTTGCCACCTTTGTCTATAGCAGGCAGATAGGTTCCCCAGCCTACCGTCAGCTGAGCTGTGCGAGGTTCCAGGATGTCTCTCAGTGCAAGTAGTGCTGTGATACCCCAGACACCATGTGAGCGTGTGCTCTAGACCTGGTGTGTGTGAGTGTGTGTGTGTGT