Transcript asmbl_19149

Sequence
Transcript Sequence for observation asmbl_19149 of TGE0032237:
TCCAGACGCTGTTTACGTAGCGTCTGGGCCGTGCGTAGCGTTAAGTTGGAGCGGTCTCCGCGGCCGCCGCCATTTTGTGCAGTTGCTGGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATGGGAGGGTGGGTAGGGAAGGAGGGACTGCTCTG