Transcript asmbl_17451

Sequence
Transcript Sequence for observation asmbl_17451 of TGE0032163:
GTGAAAGCGAAAGCTGGGGCTGCTAGCCCAGGCTCGAGAGCTGCCAAGTGGGGGGAAGCATGGCCAAGCCTTGTGGGGTCCGCTTGAGTGGAGAAGCCCGAAAACAGGTGGATGTCTTCAGACAAAATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCTGAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAGATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGGAACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCACATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTCAGGAGAAGGTGCTGGAGAGAGTGAATGCTGTCAAGACCAAAGTAGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGAGGGGACGCTGTAGCCAAGGCTTCCAAGGACACCCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAAGCAGCCTATGGGGCGCTTAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTAGAGAAAATCGTCAACCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATGATTTATACTTTATGTATA