Transcript asmbl_17336

Sequence
Transcript Sequence for observation asmbl_17336 of TGE0032154:
CCGAGGTGCGCGCTGGTGGGGAGGGGGGGCCTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGTTGTATGAAACAACAGATACAACCACTCGACTGCAGGCAGAGAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTGCTCCTCGAGAGAGGAAGTTCGTCCTACTCCCAGCTGCTGGCAGCTACATGCCTTACCAAGCTCGTGTCTCGGACAAACAACCCCTTGCCACTGGAGCAGCGGATAGATATCCGGAACTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCAACTTTCGTGACTCAAGCCCTCATCCAGCTGTATGCCAGGATCACAAAGCTGGGCTGGTTTGACTGCCAGAAGGATGACTATGTCTTCAGAAACGCAATCACAGACGTCACAAGGTTCCTGCAGGACAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTCACCAATGAAATTAATCAAGCAGACACAACTCATCCTTTAACCAAACACAGAAAAATAGCCTCTTCTTTCCGAGACTCATCACTGTTTGATATCTTCACACTTTCCTGCAATTTACTAAAACAGGCATCAGGAAAGAATCTGAACTTGAATGATGAAAGTCAGCATGGCTTGCTAATGCAACTGCTCAAACTCACCCACAACTGTCTGAACTTTGATTTTATCGGCACATCTACTGATGAGTCCTCAGACGACCTGTGTACAGTGCAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCGACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATTCCTCCCTCGTTCTCACCTTTGGTATTGTCCTGCTTAGTACAGATTGCCTCAGTCCGGAGATCCCTATTTAACAATGCTGAGAGGGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTCTGCAGACTACTGGCTCGGTTAAAGAGTAACTACCAACTGGGAGAACTGGTAAAAGTGGAAAACTACCCTGATGTTATCCGATTGATAGCCAACTTCACAGTGACCAGCCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTACCATATGTCAAAGCCACAGAGCCCCATATGCTGGAAACATATACTCCTGAGGTTACCAAAGCCTATATCACATCCCGCTTGGAATCTGTGCACATCATTCTGAGGGATGGCCTGGAAGATCCCCTGGAAGATACAGGTCTGGTCCAGCAACAGCTGGACCAGCTGTCCACCATCGGGCGTTGTGAGTATGAGAAGACATGCGCGCTCCTTGTGCAGCTATTTGACCAGTCGGCCCAGTCGTACCAAGAACTGCTGCAGAGTGCCAGTGCCAGCCCAATGGACATTGCAGTGCAGGAGGGACGACTGACGTGGTTAGTCTATATCATTGGAGCTGTGATTGGTGGCCGAGTTTCTTTTGCCAGCACTGATGAGCAAGATGCAATGGATGGTGAGCTTGTCTGTCGGGTGCTCCAGCTTATGAACCTGACAGATTCCCGCTTGGCTCAGGCTGGTAATGAGAAGCTTGAATTGGCCATGCTGAGTTTTTTTGAGCAGTTTCGTAAGATCTACATTGGGGATCAGGTGCAGAAATCCTCAAAGCTGTACCGCCGACTCTCAGAAGTTCTGGGATTGAATGACGAGACGATGGTGCTGAGTGTCTTCATAGGAAAAGTCATCACCAACTTGAAGTACTGGGGTCGTTGTGAGCCAATCACCTCCAAGACACTGCAGCTCCTCAATGACCTCTCCATCGGATACAGTAGCGTAAGGAAGTTAGTGAAGCTTAGCGCTGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACTACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCTCTAACAGCAGCGTTTGAGGCTGTGGCCCAGATGTTCAGCACTAACAGCTTCAATGAACAGGAGGCAAAGAGAACTCTGGTTGGCCTAGTGAGAGACCTGAGAGGGATAGCCTTTGCCTTCAATGCCAAGACCAGTTTCATGATGCTCTTCGAATGGATATACCCCTCCTACATGCCAATTCTCCAGCGGGCAATTGAGCTCTGGTACCATGACCCAGCCTGTACCACTCCTGTGCTCAAGCTGATGGCTGAATTAGTTCATAACAGATCTCAGCGACTCCAATTTGATGTTTCATCTCCCAATGGTATCTTACTTTTCCGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTGCCAAAGGATCAGGTCTATGCTTTGAAGCTCAAGGGTATCTCCATCTGCTTCTCCATGCTGAAGGCTGCCCTCAGTGGGAGTTATGTCAACTTTGGGGTCTTCCGTCTCTATGGAGATGATGCCTTGGAAAATGCCCTACAGACCTTCATCAAACTACTCCTCTCTATTCCTCATAGTGACCTCCTGGATTACCCCAAGCTCAGCCAGTCTTACTACTCACTACTGGAAGTCCTGACCCAGGACCATATGAACTTTATTGCAAGCCTGGAACCTCATGTCATCATGTACATCCTCTCTTCTATTTCTGAAGGACTTACTGCACTTGACACCATGGTATGCACGGGCTGCTGTTCCTGCCTAGACCATATTGTGACGTATCTCTTCAAACAGCTGTCACGGAGCACCAAGAAAAGGACAACACCCCTGAACCGGGAGAGTGACTGCTTTCTGCATATCATGCAGCAGCATCCAGCTATGATCCAGCAGATGCTGTCCACGGTGCTGAACATCATTATCTTTGAAGATTGTAGGAATCAGTGGTCTATGTCTCGACCCCTGCTTGGCTTAATACTGCTTAATGAAAAGTATTTTTCTGACCTAAGAAACAGCATCGTCAATAGCCAACCACCAGAGAAACAGCAGGCCATGCATCTGTGTTTTGAAAATTTGATGGAAGGCATTGAACGGAATCTTCTGACGAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAGGTCAACGACTCAATGAAGAATTCCACTTATGGAGTGAATAGCAATGACATGATGAGCTGACAACTCTCGGACTCTACCTTGCAGAGCAGCGTCCCTTTGGTCTGGTCCAGAGGGTGAACAGTTGCAAGGGAGAGAGCCTGGCTGATCCCGGCTCCTTCCTCCAGGGGTATGGGGGAAATGGCAAAAGTCAACCAGCTATTTCCCCAGAAAGTACGGGGAAGTACGGGGTGTGCGTGCACTCACTGAG