Transcript asmbl_17241

Sequence
Transcript Sequence for observation asmbl_17241 of TGE0032146:
CCGGCGTCTAAACACAGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAGTCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCATGGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTACAAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACGCCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGAGAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGCAAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGAAATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAGGATGTGACCTCCAAACAGGACTGGGACAAGTACTGCCACTACGTTGCTGGGCTGGTGGGAATTGGCCTTTCTCGTCTATTCTCTGCCTCAGAGTTTGAAGACCCCATAGTTGGTGAAGACATAGAGTGTGCCAACTCAATGGGTCTGTTCCTGCAGAAAACAAATATCATTCGTGATTATCTGGAAGACCAACAGGAAGGAAGGAAGTTTTGGCCTCAGGAGGTGTGGGGCAGATACATTAAGAAGTTGGAAGACTTTGCTAAGCCAGAGAACGTAGATGTGGCCGTGCAGTGCTTGAATGAACTCATAACCAACACCCTACAGCACATCCCTGACGTCCTCACCTACCTGTCAAGGCTCCGGAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTAATGGCCATTGCCACACTGGCTGCCTGTTACAATAACCAGCAGGTATTCAAAGGAGTAGTGAAGATTCGGAAGGGGCAAGCAGTCACCCTCATGATGGATGCCACCAACATGCCTGCCGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCATCTCCAAGATCAGGACACAGAACCTTCCCAACTGCCAGCTCATCTCCCGAAGCCACTACTCCCCCATTTACCTGTCATTTATCATGCTCTTGGCTGCCCTGAGCTGGCAGTACCTGAGCACCCTGTCCCAGGTCACAGAAGACTATGTCCAGAGAGAACACTGATTTTGTTTAGCCGGAAGTGGAAGTTCCCGTGGAGTGGGTTTTTCCTTTTCCTCCAGCTGGATTTTGACTTCCCTTGTTTTTCCTCCTACTCTAAAATCTTTGGGAGAACTGAGTGTGGGACCTTTAGGAACTGGGCAGAGGAAAGGATGCCTTGCCCTCAGCAGCCTGGTGCTGGCTGGGACTTGGTTCCTCTGCCTCTTGTAGCCACTGGCAGCGTGCCGACTGCTGCACTTGTGAGGCCACGTGTGATGGTCACAAGAGCCTAGTGAACCTGGCTAGAATGCTGATTGGATTTATTTAATTTGAAACAGCCTTTGAATACCTATGACAATAGAAAATGAAA