Transcript asmbl_17192

Sequence
Transcript Sequence for observation asmbl_17192 of TGE0032142:
CGCTCATTCAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGCTAGCAGATTTTGGCCTGTCCACGTTTCAGGGAGGGTCCCAGTCAGGGTCAGGATCAGGATCAGGATCCAGGGACTCTGGGGGCACCCTAGCGTACTTGGACCCAGAGCTGTTATTTGATGTCAACCTGAAGGCTTCTAAAGCGAGTGATGTCTACAGCTTTGGGATCCTCGTGTGGGCAGTGCTGGCTGGCAGAGAAGCTGAGTTGGTAGACAAGACTTCACTAATCCGGGAAACAGTGTGTGACAGGCAGAGTCGTCCTCCACTGACAGAGCTGCCTCCAGGTAGCCCTGAGACTCCCGGCTTGGAAAAACTGAAGGAGTTAATGATTCATTGCTGGGGTTCCCAGTCCGAAAACAGGCCATCCTTCCAGGACTGCGAACCAAAAACCAATGAAGTTTACAATCTGGTAAAGGACAAGGTAGATGCTGCTGTCTCCGAGGTAAAGCATTATCTGTCTCAGCACAGAAGCAGCGGCAGAAACTTGTCTGCCAGAGAGCCAAGCCAAAGAGGCACAGAAATGGATTGCCCGAGGGAAACCATGGTTTCTAAAATGCTGGACCGCCTGCATTTGGAGGAACCCTCCGGACCAGTTCCTGGAAAATGTCCTGAGAGGCAAGCACAGGACACATCAGTTGGGCCTGCCACACCAGCAAGGACATCTTCTGACCCCGTGGCTGGCACTCCTCAGATTCCACATACTTTACCCTTCAGAGGCACAACACCTGGGCCAGTCTTTACTGAGACTCCCGGTCCTCACCCCCAAAGGAATCAGGGAGATGGAAGACACGGCACTCCTTGGTATCCCTGGACCCCACCGAATCCAATGACAGGGCCACCGGCTCTCGTCTTCAACAACTGTTCTGAAGTGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCAAGTATGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCAGAGAATCACTGCAAGAGCCTGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAAGACAGTCCTTGCCACTTCCTGAAGCTCACAACATTCTGTGAGGACAGTTGGACCTACACCCAAACTGACTCTTGACCCATCTCCTTAAAGTCAATAAACATAGCATGTTAACTGTGA