Transcript asmbl_15652

Sequence
Transcript Sequence for observation asmbl_15652 of TGE0032043:
CTCGGTCACTGCTGGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTCGTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGCTCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCAGGCTCAGGCCACCCCACATCATGCTGCAGCGCTGCCGAGATCATGGCTGTCCTGTTTTTCCATACCATGCGTTACAAGGCCCTGGATCCCCGAAACCCTCACAATGATCGATTTGTGCTCTCTAAGGGCCATGCAGCTCCCATTTTATATGCAGTCTGGGCTGAAGCTGGCTTCCTACCCGAGGCCGAGCTGCTGAACCTGAGGAAGATCAGCTCTGACTTGGACGGGCATCCTGTCCCGAAACAAGCCTTCACCGATGTGGCCACTGGCTCCCTGGGCCAGGGCCTGGGAGCTGCTTGCGGGATGGCATACACAGGCAAATACTTTGACAAAGCCAGCTACCGAGTCTATTGCATGCTGGGAGACGGGGAGGTCTCCGAGGGCTCCGTCTGGGAGGCCATGGCCTTTGCTGGAATTTACAAGCTGGACAACCTCGTTGCCATTTTTGACATCAACCGCCTGGGCCAGAGCGACCCAGCCCCGCTGCAGCACCAGGTGGACATCTACCAGAAGCGCTGTGAGGCCTTTGGCTGGCACACCATCATCGTGGACGGACACAGCGTGGAGGAGCTGTGCAAGGCCTTTGGTCAGGCCAAGCACCAACCAACAGCCATCATTGCCAAGACCTTCAAGGGCCGAGGGATCACAGGGATTGAAGACAAGGAGGCGTGGCACGGGAAGCCCCTCCCCAAAAACATGGCCGAGCAGATTATCCAGGAGATTTACAGCCAGGTTCAGAGCAAAAAGAAGATCCTGGCCACGCCCCCTCAGGAGGATGCCCCATCCGTGGACATTGCTAACATCCGAATGCCTACGCCACCCAGCTACAAAGTGGGGGACAAGATAGCCACCCGGAAGGCCTATGGACTGGCCCTCGCTAAGCTGGGCCACGCCAGTGACCGTATCATTGCCCTGGATGGAGACACCAAGAATTCCACCTTCTCGGAGCTCTTCAAAAAGGAGCACCCAGACCGGTTCATTGAGTGCTACATTGCCGAGCAAAACATGGTGAGCATTGCCGTGGGCTGTGCCACACGTGACCGGACAGTGCCCTTCTGCAGTACTTTCGCGGCCTTCTTCACACGGGCCTTCGACCAGATTCGCATGGCCGCCATCTCTGAGAGCAACATCAACCTCTGTGGCTCCCACTGTGGTGTGTCCATTGGGGAAGACGGGCCCTCTCAGATGGCCCTCGAAGACCTGGCCATGTTCCGGTCAGTCCCCATGTCCACCGTCTTTTACCCAAGCGATGGAGTTGCAACAGAGAAGGCAGTGGAGTTAGCAGCCAACACAAAGGGCATTTGCTTCATCCGGACCAGCCGCCCAGAGAATGCCATTATTTATAGCAACAATGAGGATTTCCAGGTCGGCCAAGCCAAGGTGGTCCTGAAGAGCAAGGATGACCAAGTGACAGTGATCGGGGCTGGTGTAACTCTGCATGAGGCCTTGGCTGCTGCAGAGAGTCTAAAGAAAGATAAGATCAGCATCCGGGTGCTGGATCCCTTCACTATCAAGCCCCTGGACAGGAAACTCATCCTAGACTCTGCCCGAGCAACCAAAGGCAGGATCCTCACCGTGGAGGACCACTACTACGAAGGTGGCATAGGAGAGGCAGTGTCTGCTGCCGTAGTGGGTGAACCTGGAGTGACGGTCACTCGCCTGGCTGTCAGCCAAGTACCACGAAGTGGCAAGCCAGCTGAGCTACTGAAGATGTTCGGTATTGACAAGGACGCCATTGTGCAAGCTGTGAAAGGCCTTGTCACCAAGGGCTAGGGAGGGCATGGGATGCTGGGTGGGTGAACTACACATTCCAGGGAGGTTCTGGCAGAGGTGGCGAAGGTGTACTGAGTGGGGAGGTAAATATATGTTTTGAGAAAAAAA