Transcript asmbl_15625

Sequence
Transcript Sequence for observation asmbl_15625 of TGE0003333:
CGTTGATATGATTGGTCGGCAGTGAGCGGTCCTCTTTTCCTCCTCTCCAGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTTCATGACCAACCGTCTGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTACCAAAGACAGAAATTCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTGGATTCAGAACCCACTTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGCAAAGAAGAATGAGCCTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGTGGAGATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGATTTCTGAGAGGACAAATAAACTAAAAAGCTCCTACA