Transcript asmbl_13836

Sequence
Transcript Sequence for observation asmbl_13836 of TGE0036026:
CGGAACAACATGGCTACAGTGTTTCGGCCCCTGGAACGCCTGCGGGTGCCGCGTCCTTCGCTGCATCCCGGGGTGACGGGCTCAGGCTCCGCCTGCTGCCGCTGCACTCTCGGAGCTAAAAGATACCTACTCACAGATAACATTGTGAAGTTAAAGGAATTTCAACATAAGAAGATAGCTATTGCATATAACCTACCTGGCACCAAAGAAATCTATTTCAGAAACTTGGAAGAGAAGTTGACCCAGAACAAACTCATCTTGAAGGAAGAGTTGAAAACGCTGCTGTACCTGTGCCAGTCCCTGGAAGATGTGCAGCTGGCGAAAGCCGTCATTTATAGGTACCATGCAGAAAACAAGAATTTCACTTTGGGGGAATACAAGTTCGGACCAGTTTTCATGAGGCTGTGCTACGAGCTGGACCTGGAGGACTCTGCAGTGGAGCTCGTCAGAGACAAGCATCTACAAGGCTTCTTCCTAGATTCAACGTCATTCAATATTTTGATGGATATGTTATTTACCAAAGGCAAATATGAACGTGCACTTCAAGTGTTGATCGAAATGAAAAACCAAGATGTGAGGTTCAGCAAAGAAACCTACATCCTCGCTTTTGCAATCTGCTACAAACTGAATACCCTGGAATCGCTTAAAATCTGTACTACGTTAAGAGAAGAAGCCCTAATTAAGGGAGACATTATCTGCAGGAGAGCATACTGTTTTGTAGTGGCATTAGCTCTGAATAAGAACCAGTTGAAAAACGCTGTGTCCATTTTTTCTCAAATCGTGAATCCAGAAAGCATAGTGTGTATTAACTTAAATATCTTGATCCACATCCAGTCAAATATGTTGGAAAGCCTGTTAAAGATCTTAGAGGACTCTCTTGACACAAATTTATCGAAATTTGTAAGAAGACACACATTCTCAGAGGAAGTGCTGGCCAAAGTGAGGGAAAAACTGAAGGACAGCCCTGCACTCATAGCCAGATTCGATGAGGTCTATGGGAAGCTGCACGTGAACGGTCAAATCACCGTTCATTCTTTGGATGCTCTGCTCTGCCACGTCCCCCGGGACAAGAGATCCAACTTGTTGCTGTTAAAGAAGAGGGCAGTCAGCCACCGGACCTTACAGCCTCTCAGCCGGTCCCTGCTGACCGAGTAACTGCTTTCCATTTCCCTGGTCTGGAGCAGCTGCTGCTACAGTGGATTACTGGCTGCTCCGGGCCGGGCATCTTACTTACTTCAGTGGCCCTGTGCTGACGCTTGGTCTCCCTAAGTCCTAAGTCCCCCGAGTGGTGACATGCTACCAGAGAAATGGGAAGAGCTAGCTCGAGCCAAGGGAGCCCCACAGAAAGGCAGCTGCCCTCGTTTCACAGGCTCCAGAGTAAGACTCAGAGCTGCTAATGCAGCCCAGTAGAGTGGAGCTCAGGAGGTACCCACAGACGGGATTTCTCTTGGTCTTGACTGACCTTTCACGGCAGAGGTGACTCGCAAGTTGGTGGGGAGACCTGAAACCCTCATCTCCCATCTTTGGAAGTGGCGGAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGTTCAGCTTTCTCCAGAATAAGAAATAAAAGGTTCCTGTGCAGA