Transcript asmbl_13539

Sequence
Transcript Sequence for observation asmbl_13539 of TGE0031913:
GTCTTGCCCTGCAGTTTCTGCTGGGCCTAAGCCTCCGGGCTCAGTTTGACCACAGTATCTAGCTATGGCGGCAGTGACCTGGAGTCGGGCTCGATGCTGGTGTCCGAGATGCATGCTGTTCTGATCAACATGAGTTGGAGCCAATCAGTAATCCTGTTGCTGCAGAAATAAAAGGGCAAGGAACAAACAGAAACCACTATTTGTAGTGTCCTGCAGGTCTTCAGATTACAAGTGGCTAAACTGCACTTGGGCAGACCAACAATGAGAGCCAGTCAGCAGGACTTTGAAAATGCATTGAACCAGGTGAAACTCTTGAAGAAGGACCCGGGAAACGAAGTGAAGCTAAGACTCTATGCACTGTACAAGCAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTATGCTTGACTTTGTCAACAAAGCCAAGTGGGATGCATGGAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGCAGAACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTGATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGTATCACGAAGATCACGTTCAATCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCGGGATATTATACTCGCACTTAAAAATGCCAGCACTGATAACACTGTCATGGCTGTTTTCACAGGAACTGGTGACTACTACTGCAGTGGGAATGACCTGACTAACTTCACTAGTGCCACTGGGGGGATAGAGGAGGCAGCTAGCAACGGTGCTGTGTTACTGAGGGACTTTGTAAACAGTTTTATAGACTTTCCCAAGCCTCTGGTTGCGGTAGTAAATGGCCCAGCTGTGGGAATCTCTGTCACCCTTCTGGGACTATTTGATGCTGTCTTTGCATCAGACAGGGCAACGTTTCATACTCCATTCAGCCAACTCGGCCAGAGCCCGGAAGCATGCTCCTCTTACACGTTTCCGAAGATGATGGGCTCAGCAAAGGCAGCTGAGATGCTTCTCTTTGGGAAGAAGCTGACAGCAAGAGAGGCCTGGGCTCAAGGCCTTGTCACTGAAGTTTTCCCTGAGAGCACTTTTGAGACAGAAGTCTGGACCAGGCTGAAAACATATGCGAAGCTCCCGCCAAACGCCATGAGAATTTCCAAAGAGTTAATCAGAAAAAATGAGAAAGAAAAGCTCTACGCAGTCAACGCTGAAGAGTGCACTACTCTGCAAGCAAGGTGGCTGTCAGAGGAGTGCATGAACGCAATCATGAGCTTCGTCTCCAGAAAACCAAAGCTGTGAAGACCACCACAGCAGCTAGACTCCTCATAGGGAGCATGGGCTGGGAGGTCCAGTTTCGAGGACTCAAACGACACATGCTTCTCTGTGCCTTTTCCTTGATTAACGTAGCAATTATGATGAGAATTCTTCACAGTACTGATAAATAAAACTTTTCATAAATCAA