Transcript asmbl_12241

Sequence
Transcript Sequence for observation asmbl_12241 of TGE0031860:
TCGCTTTGGTGGATGCACTTCCGGCGGTGGCGATTTGGAGGACTGAAGGAAGATGGGTCAAAGCCAGAGTGGTGGCCATGGTCCTGGGGGTGGCAAGAAGGATGACAAGGACAAGAAAAAGAAATACGAACCTCCTGTCCCAACTAGAGTGGGGAAAAAGAAGAAGAAAACAAAGGGACCAGATGCTGCCAGCAAACTGCCACTGGTAACACCTCACACCCAGTGCCGCCTGAAATTACTGAAGCTAGAGAGAATAAAAGACTATCTTCTCATGGAGGAGGAATTCATTAGAAACCAGGAACAGATGAAACCATTAGAAGAAAAGCAAGAGGAGGAAAGATCAAAAGTGGATGATCTCAGGGGGACCCCCATGTCTGTAGGAACCTTGGAAGAGATCATTGATGATAATCACGCCATTGTGTCCACATCTGTGGGCTCAGAACACTACGTCAGCATCCTGTCGTTTGTAGACAAGGATCTGCTGGAACCAGGCTGCTCCGTCCTGCTCAACCACAAGGTGCATGCTGTGATAGGGGTGCTAATGGATGACACGGATCCCCTGGTCACAGTGATGAAGGTGGAAAAGGCCCCCCAGGAGACCTACGCAGATATTGGGGGACTGGACAACCAGATCCAAGAAATTAAGGAGTCTGTGGAGCTCCCGCTTACCCATCCTGAGTATTACGAGGAGATGGGGATAAAGCCCCCTAAGGGGGTCATTCTCTACGGTCCGCCAGGAACAGGTAAAACTCTATTGGCCAAAGCAGTAGCGAACCAGACTTCAGCCACTTTCTTGCGAGTGGTTGGCTCAGAGCTTATCCAGAAGTACCTAGGTGACGGGCCCAAACTTGTCCGGGAGCTCTTCCGGGTCGCTGAGGAGCATGCGCCGTCCATCGTGTTCATTGATGAGATCGACGCCATTGGGACCAAAAGATATGATTCAAATTCTGGAGGTGAGAGAGAAATTCAGCGAACAATGTTGGAACTGTTGAACCAGTTGGATGGATTTGATTCGAGGGGAGATGTAAAAGTTATCATGGCCACAAACCGAATAGAAACTTTGGATCCAGCACTTATCAGGCCAGGCCGCATTGACAGAAAGATCGAGTTCCCCCTGCCGGATGAGAAGACCAAGAAGCGTATCTTCCAGATTCACACCAGCAGGATGACACTGGCTGATGATGTAACCTTGGATGACTTGATCATGGCAAAGGATGACCTCTCTGGGGCCGACATCAAGGCAATCTGTACAGAAGCTGGCTTGATGGCCTTGCGGGAACGCAGAATGAAAGTAACAAATGAAGACTTCAAAAAATCTAAAGAGAATGTTCTTTATAAAAAACAAGAAGGCACCCCTGAGGGGCTCTATCTCTAGTGGCCCACAGTCGTCCTCAGGGATGGGGAGCTGTCCCCAGGAACCCATTCTCCAGTTCAGGTTTGCCAGTAGAAAGCCTGTATCGTGGAGGACACTGTGCCTCCATCTGTTGTTGGTCATTGTGCCGTGCTGCTCTCTACTCCCAATAAAGGATTGGCCTGGTTTGCTTTCTA