Transcript asmbl_11635

Sequence
Transcript Sequence for observation asmbl_11635 of TGE0000454:
ATCACTTTAGCCGCCTGTCAGTTAATTAGAGTACAGAAGGCAGAATCCCGAAACGAACTCTTCTTCCTAAAGCGGAGAAAGAGTCTCTTACCCATCCCGGCGCCCTTAACCAAGATGGCTGAAACAGCGTCAGTATCCACTCTAGAAACCAGAAACGTGTGTCTCTCTATGGTCTGAAAGATTCCTTTTGCGTCGCGCTTTCGACGACTTCCGGCGGCGGCTCTCGCGGGATTGGCTGTTGGCGGCGTTGCGGCTGAGCTCGTGTGCGGCAGCAGAGGTGTTAGCGGCGGCTGCAGCAAGAGCGTTTGGCGCGATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAGGGCAGGACTTATGCTGACTATGAGTCTGTGAATGAGTGCATGGAAGGTGTTTGTAAAATGTATGAAGAACATCTGAAGAGGATGAATCCCAACAGCCCTTCCATCACATACGATATCAGCCAGTTGTTTGATTTTATTGACGATCTGGCAGACCTCAGCTGTCTGGTTTACCGAGCTGATACACAGACATACCAGCCGTATAACAAAGACTGGATCAAAGAGAAGATCTACGTGCTCCTCCGTCGGCAGGCCCAACAGGCTGGGAAGTAATTGAGTCGGAAGCATTGGGGCTGGGGGTGGACTTGGAACAGGTACATACAGCGTGCTGTAGTGAACCTTTTGTATGATAGCGATCCTGTTTCAACGTTGTTACACTCAAGCCAAGATTGAATGTCTGACATGAACCGTGAATGATCTTGTCACTCTGAAGCCACCGTGGCCCTTTGCTCCTTTACTTTCATTTTTTTACTTAAACATTTTTATGATAATACAAATAGAAAACATTTTTGCCATTTAAGGTTGGTTCCGGTCCTTGAAACTGTCGAGTCTGCTTTTAAGCAGTGAGCGCACTAACCCTTTGTGGGGGTGGGGTGGGGACAAGGTTAGTCATATAGCCTCTGGGAAAGTCTCAGTGAAAAATAAAGAAATGTTCTGTAGTTGTA