Transcript asmbl_11388

Sequence
Transcript Sequence for observation asmbl_11388 of TGE0039097:
AGCCAATCTGCCTGCCATTGCTTTCTGGATATGGATTAACAAACATCCTTGCAGAGATTAGATTTCACTGCTACCACCCTGCTCCTGCCATACTGAATAGAAGGCCCCAAATCAGAGTTTGGACAGGAGTCGGAAAATACAGATCCGCAATATTCCACCTCAGCTCCGATGGGAAGTGCTAGATAGCCTGCTGGCTCAGTACGGTACAGTGGAGAACTGTGAGCAAGTGAACACTGAAAGTGAGACAGCTGTGGTCAACGTCACCTACTCTAACCGGGAGCAGACCAGGCAAGCTATCATGAAGCTAAATGGCCATCAACTGGAGAACCATGCCCTGAAGGTCTCCTACATACCTGATGAGCAGATAACGCAAGGTCCTGAGAATGGGCGTCGTGGAGGCTTTGGGTCTCGGGGCCAGCCCCGGCAAGGGTCGCCCGTGGCAGCAGGGGCTCCAGCCAAGCAGCAGCCAGTGGACATCCCTCTCCGGCTCCTGGTGCCTACGCAGTATGTAGGCGCTATCATTGGCAAGGAGGGTGCCACCATCCGAAACATCACAAAACAGACGCAGTCCAAAATAGACGTGCATAGGAAGGAGAATGCGGGCGCTGCGGAGAAGGCCATCAGCGTGCATTCAACCCCTGAAGGCTGCTCCTCCGCGTGCAAGATGATCTTGGAGATTATGCACAAGGAGGCAAAGGACACCAAAACGGCAGATGAAGTTCCCCTGAAGATCCTGGCTCATAACAACTTCGTCGGGCGACTCATTGGCAAGGAAGGGCGGAACCTGAAGAAGGTGGAGCAGGACACAGAGACGAAGATCACCATCTCATCGCTCCAGGACCTCACGCTCTATAACCCTGAGAGGACCATCACTGTGAAGGGCGCCATTGAGAACTGTTGCAGGGCCGAGCAGGAGATCATGAAGAAAGTTCGAGAGGCTTACGAGAACGACGTGGCCGCCATGAGCTTGCAGTCCCACCTCATCCCTGGGCTTAACCTGGCTGCTGTAGGTCTCTTCCCAGCTTCATCCAGCGCTGTCCCTCCTCCTCCCAGCAGTGTCACCGGGGCTGCTCCCTATAGCTCCTTCATGCAGGCTCCGGAGCAGGAGATGGTACAAGTGTTCATCCCCGCCCAGGCTGTGGGCGCCATCATTGGCAAGAAGGGCCAGCACATCAAACAACTCTCCCGCTTCGCCAGCGCCTCCATCAAGATTGCACCACCAGAAACACCTGACTCCAAAGTTCGAATGGTCGTCATCACTGGACCCCCAGAGGCTCAGTTCAAGG