Transcript asmbl_11325

Sequence
Transcript Sequence for observation asmbl_11325 of TGE0031751:
CCGGAAGTGACCGTCCGAGCGGCGGGCGGCGGACGACGTTCGTCATTTGGTGCGGGAGGGAGCGCGAGAGCGGCGGTCGAGCCTCCGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTCAAAATTGACAAGACTGACTACATGGTCGGGAGCTATGGGCCGAGGGCCGAGGAGTATGAGTTCCTGACACCCATGGAGGAGGCTCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCGCGCTTCACAGATGACGACAAGACTGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAGTGGAAGGACTGAGCTCCAGCTGGGAGACGGGCAGGGCGACGGACAGACAGAAGGACCGACATGCCCCACCCTAACCCCCTACCTACCCCAAACCAAAGTGCTGACAGGACCTCCCTCACCCGTCATTCCTCCCTAGTCCACTCAGGCAGTCAGCTCTCCTGTCTGCCCCTCCTCCACCTCCTGCCCGCAGGCCCCTGTGGTCTCCAGTGTCACATTGCTGCTTCTGCCTGTGCAGTGGGGGAGGGGTTCCAGCCCAGGCCTCCAATCTGCTGTGTCCCTCCAGGTTCCCTCTGTCTTCCCTTCCTCAGGCCCTGGCTTCTAGAATGGAACAGAACACTGTCAGGGTTGTCCAGCCCACCTTGTCTCTGTCGCAGCATGGGGAAGGGCTGGGCTATCTGTCCTCTAGTCCCACCACTCCCTGGCCAGGTCATCCATCACTGTCAGTCACTGTCTAACCATGATGCCTTAACATGTGGAACGTGTGCTGGGGGCCGTCGCTAACTCTTAACTCCCTGTCTGCATGAGCATGTGCTCTCCCTGTCCTCGCCTCGTCTGCCATCCCCATCCCAGTGACCCACCCAAGGGAGGCCTGGGGTGCGCTGCTGTTGCTTCCTGCGAGCCTGGCCAGCTCTTCCCCTCCCCGTGGCCAGGGTTGGGGGTGGCTCCAGTAGCTAGGGGAGGGTCAATTGCCAAAACTCGATGCCTCCAGCCCCATCTAGGAGGCAGGGTAGGGTGCCTCATTCCTCTGCCTTCTCTGTCCCTTGTAGGCAGTACTCGGAGCCCCTGTCCCCACAGAGAGCCCCTGAGGGACAAAGCCAGCCGAGCCTTACTTGTCTCACCTGGGCCACGTGGCCTGAACCTCGTGCCTGGCCTGTCAGTATTTATTGCCTCCATTTGGGCCAGCTGGCCTGATGCCTCTGCCCTGGTTCTTGGTGCCACCATCCCTGGGCCGACCCTCCCTGGACCCAGCCAGGACAAATGTGGGACCAAGTTCACACAGTTGGGAGCTGTCTCCTGTGCCTCCCCTCCCTATCCCCAGTCCCTGTGTGGTGTCTGCCAGGCCCAGCCTCAACAGGCAGAGGAGCCTGTCCCTGCTTCTCTTCTGACTGGGAAATAAACACCCCTGAAGGAGTC