Transcript asmbl_11169

Sequence
Transcript Sequence for observation asmbl_11169 of TGE0039074:
CTGGAGTCACAGCCGGAGCCCGCGGCAGAGTCGGAATCCGGGGTCGGGCTGGAGCGGGGTCCATCGACATGGGATCCGCAGACTCCAAGCTGAACTTCCGGAAGGCGGTGATCCAGCTGACCACCAAGACGCAGCCCGTGGAAGCCACCGACAATGCTTTCTGGGACCAGTTCTGGGCAGACACCGCTACCTCGGTGCAGGATGTCTTTGCGTTGGTGCCGGCAGCAGAGATCCGGGCTGTGCGAGAGGAGTCACCCTCTAACCTGGCCACGCTGTGCTACAAGGCTGTGGAGAAGCTGGTGCAAGGAGCAGAGGGTGGCTGCCACTCTGAGAAGGAGAAACAGGTCGTCCTGAACTGCAGCCGGCTACTCACCCGAGTGCTGCCTTACATCTTCGAGGACCCCGACTGGAGGGGCTTCTTCTGGTCCACAGTGCCCGGGGCAGGGCGTGGAGGGGGTGAGGAAGAGGATGAGAACGCTCGTCCCTTGGCTGAGTCCTTGCTCCTGGCCATTGCCGATTTGCTCTTCTGCCCAGACTTCACTGTGCAGAACCACCGGAGGAACGACGTGGACTCAGCAGAAGATGTCCATTCCCTGGACAGCTGTGAATATATCTGGGAGGCTGGTGTGGGCTTTGCTCATTCCCCACAGCCCAACTACATCCATGACATGAACCGGATGGAGCTGCTGAAGTTACTGCTCACGTGCTTCTCAGAGGCCATGTACCTGCCCCCATCTCCAGAGAGTGGCAGCACCAACCCCTGGGTTCAGTTCTTTTGTTCCACGGAGAACAGACACGCGCTGCCCCTCTTCACTTCACTCCTCAACACCGTGTGTGCCTATGACCCTGTGGGCTACGGGATCCCCTACAACCACCTGCTCTTCTCGGACTACCGGGAGCCCCTGGTGGAGGAGGCTGCTCAGGTGCTTATTGTCACCTTGGACCATGACAGTGCTACCAGCACCAGCCCCACCGTGGACGGCACCACCACGGGCACAGCTATGGATGATGCTGATCCTCCAGGGCCCGAGAACCTGTTTGTGAACTACCTGTCCCGAATTCATCGTGAGGAGGACTTCCAGTTCATCCTCAAGGGGATCGCTCGGCTGCTGTCCAATCCCCTGCTCCAGACCTACCTTCCCAACTCCACCAAGAAGATCCAGTTTCACCAGGAGTTGCTTGTTCTCTTCTGGAAACTCTGTGACTTCAACAAGAAATTCCTCTTCTTTGTACTGAAGAGCAGTGACGTGCTGGATATCCTGGTTCCTATCCTCTATTTTCTCAACGACGCCCGGGCAGATCAATCTCGGGTGGGCTTGATGCACATCGGGGTCTTCATCCTGCTGCTCCTGAGTGGGGAGAGGAACTTTGGGGTACGGCTGAACAAGCCCTACTCAGTGCGCGTGCCCATGGACATCCCGGTCTTCACAGGCACACATGCAGATTTGCTCATTGTGGTATTCCACAAAATCATCACCAGCGGTCATCAGCGGTTGCAACCCCTCTTCGACTGCCTGCTCACCATTGTGGTCAACGTGTCTCCCTACCTCAAGAGCCTGTCCATGGTGACTGCCAACAAGCTCCTGCATCTGCTCGAGGCCTTCTCGACCACCTGGTTCCTCTTCTCGGCATCTCAGAACCACCATCTGGTCTTCTTCCTTCTGGAGGTCTTCAACAACATTATCCAGTACCAGTTTGATGGCAATTCCAACCTGGTCTATGCCATCATCCGTAAACGTGCGGTCTTCCACCAGCTGGCCAACCTGCCCACTGACCCACCCTCCATCCACAAGGCACTTCAGCGGCGGCGGAGGACACCAGAGCCCCTGTCCCGTACTGGTTCCCAGGAGGGAACGTCCATGGAGGGATCCCGCCCTGCTGCCCCTGCAGAACCAGGCACCCTTAAGACTAGCCTGGTGGCCACTCCAGGCATCGACAAGCTGACAGAGAAATCCCAGGTATCAGAGGACGGCACCTTGAGGTCTCTAGAGCCCGAATCCCAGCAAAGCTCAGCAGAAAACAGCCCATCTGATGGGGAGTCCAGCCAAACATGGAGAGAGCAACGGAGATTGTCCAATGCATCAGCCAGTGGCCAGTGGAGCCCAACATCAGATTGGATCTTGTCCTGGAAGTCAAAGCTGCCGCTGCAGACCATCATGCGCCTGCTGCAGGTCCTGGTTCCCCAGGTGGAGAAGATCTGCATTGACAAGAATGTGGACCCACCTATCTGGTATGACACTGACGTGAAGCTGTTTGAGATCCAGCGGGTGTGAGGATGTCGACTTGAGGGAATAGGGCCGGAAGAGCTGGTTCTAGTCCCCAGTGCTCCCAAACCCATTGTTCTGAGCTTAAAGATCCATTATCAGGGTGTGGGGCGAGCAGAGTAGTTGGTCCTGGATGGCAGGTCCCAGGTGCCCATTGTGGCTGGAGACACAGGGATTTAAAAAAAAAAGTGCCCCTCTGCCCTCCAGGCTGTTCTAGGAGCCTCTTGTCTCCTCCAGAGATACAACCCCATCAGAACCCCTGCCCACTCTGGCTCCTCCTCCAAGACCTGCCCTTGTGCTGCCTGCTCCCAGAAGCTGTCAGGTCACTGTGCCCTAATGGGTTGTCTCAAAAAGGAGCCATGTGCTGCCCCGTGAGGGCACCTGGTCATGGTAAAGGGAGTTCTGGCTACCTAGTCTGAGACTTCTGTTCCAGGCGTCCCTTTTGCCAGCGCCCTGGTTGGGAAGAGCGACTCAGCCGCTAGTGAAGAAGGCTGGAGGCTGACGCTTGTGAAGCAGGACCGTGGAGTGTGCTTTAGGGGCTTGGAGTAGGGTATCGAGAGTGCCCTGTTACTGTCCGGGGTCGGGGGAATCTGCCTGGCTGGTGGAGCCTGAAGGATGTCGGTGTCCCTGCCTTATCTGCGGCCTGGGTGGTGGGAGTTACACTCTATGAGCCCCAGCTCTGGCCTCCCGGTCGCCCTTGCCTCCCCTGTGTCAGTACAATCTTTGCTCTGTACAATCGGCCACTTTACACAATAAAATGTCCC