Transcript asmbl_9828

Sequence
Transcript Sequence for observation asmbl_9828 of TGE0000759:
GCAGATAATGGGCGGAGCCTGCGGCCCACAAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTACAGAAGAGGCTTGCCTCTAGTGTCCTCCGCTGCGGGAAAAAGAAGGTCTGGTTGGATCCCAATGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCAGGAAGCTGATCAAGGATGGGCTGATCATCCGCAAGCCTGTGACTGTCCATTCCCGGGCTCGTTGCCGGAAAAACACCCTGGCCCGACGGAAGGGCAGGCATATGGGCATAGGGAAGAGGAAGGGTACTGCCAATGCTCGGATGCCTGAGAAGGTGACCTGGATGAGAAGGATGAGGATCCTGCGCCGGCTTCTCAGGAGATACCGGGAATCCAAGAAGATTGACCGCCATATGTATCACAGCCTGTACCTGAAGGTCAAAGGGAATGTGTTCAAAAACAAGCGCATCCTCATGGAGCACATCCACAAGCTGAAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCTCGCAGGTCTAAGACCAAGGAAGCACGAAAGCGCCGGGAGGAGCGCCTCCAGGCCAAGAAGGAAGAGATCATCAAGACTCTGTCCAAGGAGGAGGAGACCAAGAAATAAAGCTTCCCTCGTGTCTGTACATAGCGGCCTGGCTGTGGCCTCATGTGGATCAGTCTTTAAAATAAAACAAGCCTTTGTCTGTT