Transcript asmbl_41671

Sequence
Transcript Sequence for observation asmbl_41671 of TGE0005521:
TAGAATCTGGGGCTCAACGTTGGTCTCTTGGGAATGTGGAGAGCTGGCAGCATGTCGGCGGAGCTGGGAGTCGCGTTCGCTCTGCTGGCAGTGAACGAGCGCGTGCAGCAGGCGGTGGCACGGCGGCCGCGGGATCTCCCGGCCATCCAGCCCCGGCTAGTAGCCGTCAGCAAAACCAAACCTGCAGACATGGTGATTGAGGCCTATAGTCATGGCCAGCGCTCTTTTGGGGAGAACTATGTTCAAGAACTGCTAGAAAAAGCATCAAATCCTAAAATTCTGTCTTCATGTCCTGAGATCAAATGGCACTTCATTGGCCACCTGCAGAAACAAAATGTCAACAAATTGATGGCTGTCCCCAATCTCTTCATGCTGGAAACAGTGGATTCTATGAAGTTGGCAGACAAAGTCAACAGTTCATGGCAGAAAAAAGGTTCCTCTGAAAGGTTAAAGGTTATGGTCCAAATTAACACCAGTGGAGAAGAGAGTAAACATGGCCTTCTACCTTCAGAGACAGTAGCCATGGTGGAACACATAAATACCAAGTGCCCCAGCCTGGAATTTGTGGGGCTGATGACCATAGGAAGCTTTGGGCATGATCTTAGTCAAGGACCAAATCCAGACTTCCAGATGTTATTGTCTCTCCGGGAAGAGCTATGTAAAAAACTGAACATCACTGCTGACCAGGTTGAGCTGAGCATGGGCATGTCCATGGACTTCCAGCATGCAATTGAAGTAGGATCTACGAATGTCCGCATTGGAAGCACCATTTTTGGAGAGCGAGATTACTCAAAGAAGCCTGCCCTGGACAAGTCCGCAGCAGACCTGAAGGCCCCCATAGAAGTAACACAGGCACACTGAGCCAAGGAACAGCCAGCAGTGGCTCACAGCCTGTGGCCCTGTCCAGGAAGACTAACTATGCACCCATCTGGATTTTCATTTTGATATTCCCTAAGTTACAGCACAACCATGCTCTCTTTGTGACCTGGAGAGAGTGTGCTGAGGATTTTGTGTGCTGATGGAAATCTTCTGTATTTAGTGTCTGACATAGGGAGCTCGCTTCAAGTAATGGCCTTTGGATTGGATTTGAGAAATCCAGACATTTCTGCAGATATAAAATCAATAGGCAGGAATTGAGTTCAATATTAAATCCTGCCTGGGAGCACCAACTGACACATCAATGCCTTTCCCAGGTTAATATTTGGTCACTGGTGCCTATAATCTCCAAAGTCAGAGGGATTCCCATTTGTCGTTCACTTTAATAGAAAATTCCCTGTGGTTACAGACTCCATACAAACCCCTACTGAGTAATCATCTCTGCTGCCCTGGAGGAAGGTGATTTCTTCCCCGCCCCGTAAACCCCCACCTCCCTCCCAC