Transcript asmbl_41629

Sequence
Transcript Sequence for observation asmbl_41629 of TGE0005512:
GGGCCATCCCTCAGGCTTCTCCCGCTTCACGTCAACCCCTGCCCTGGCCACCTGCGCTCCGGGCCCAGCTGCGCACGCGCGCATCCAGAGCCAGACAGTTGGTGGTGTTGGTACGCCCCAGCTGTTCCTCTCCGCACGCAACCCCGCGTCGCGCGACCCCGGTGTGACACCACGGCGCAAACGCGGCGCGGGGGGAGGCAGGGGCGCGCAGGCGCCGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGCCAAAGTAAATAATGCCAGCCTGATTGGACTTGGTTATACTCAGACCCTTCGACCAGGAGTCAAACTGACCCTGTCAGCTTTAGTCGATGGAAAGAACTTCAATGCAGGAGGTCACAAGGTTGGGTTGGGATTCGAACTAGAAGCTTAATGTGGTTTTGAATAAAGCATCAAATTTGTTCCTGGAGGTGAAGAGAAATGAATCCACTATGTTTTGGCCTTAAAATTCTTCTCTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACGCTGAAGTCTAGAGATCGCAAGTCCACCCTAAGGGAGGTCCTTAAAGGCATGCCTGGAAGTTGTTATGTTTGTGCCACATTTCAGTTCCGCAGTATTATTTTAAATGTGTTCCTCGGCGACAATGTAGTGTCATGTTAAAGGAAATGACTCGATCCTCCAGTTTGTACATCACGTCCTGCATGTCCCACACCACTTTTT