Transcript asmbl_9058

Sequence
Transcript Sequence for observation asmbl_9058 of TGE0001383:
TCGCCGGCGGCCATTTTGGGTGGAAGCGATCACTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGTCGGAGTGGGGTCGACGTTTGCTCTACCGGAACAGCTTAGCTCATTCCTCCCTTTCCATTACCTGTGGCGCGGAGAGTTGGGGCGGCGGCTGCGTCAGCAAGGGCGGTGGTGGCGGCGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGATTCTGGGGTTGGAAAGTCCTGCCTTCTCCTTAGGTTTGCAGATGATACGTATACGGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAGATACGAACTATAGAGTTAGATGGGAAAACAATCAAGCTACAGATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACTTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAGATAGATCGCTACGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGACCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCAGATTCCCTTGGAATTCCATTTTTGGAAACCAGTGCTAAGAACGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCTACAGCTGGTGGTGCCGAGAAGTCCAATGTTAAAATCCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGCTGCTGCTAAAATCTGCCTCCGTCCTTTTCTCACAGCAATGAATTCGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTTTCCACAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTTATTCCCTTGACTCAAGACCGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGATCGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTTGGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCACACAGCACAACCAGTGTCTGTCAGTTTCCACGCATAAAGTTTAGTGAGACGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTGGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTAATTCCTATGATTAAAGGGAAATAGAGCTTTGCATTCTACTCAGCAGCCACGTGTGTGCAGCAAGGGCACTGTAGACCTATCTTAATAGCACAGCATCCAGGGTTTGCTTTCTAGTAATAGGTCTGATGAGTGACCTAGAGAAGCTTTTGTGCTGTGTAGAGACTTCACCACCTTCATTGGTTCAAGGAACTCAAACTCTAGTGCTTCATCTCCAGCCCAGGCCACCTGAAGTGGCTTCACCAGCAACCCTTTTTTCCCTCATCTGTGGTAGAGATGGAGAGCAGCCCATGCTTCCTCCCAGGCAGTGATCTGGTAATAGTGCTGGTGTTTCTTCATGCTCAGTCTGATGGCGCACACACCTTTTTCTTTCTTTTTTCTTTTTGGCTATTGGAGATAGGGTTTCTCTGTGTATCCCTGGC