Transcript asmbl_774

Sequence
Transcript Sequence for observation asmbl_774 of TGE0003178:
GGAAAGCCTCGGTGTCAGCCATCTTTCAATTGTGTTCGCAGCCTTCGCCGCGCCGCTGCCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTGTCCTTACCATGGCTCGTACAAAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCCCTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTTCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGCGGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTTCCTCTTCTTCCTGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGGTACCTAAGTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCACGTTCATTTGTGTGTGAATTTTTAATATAAATGCAAGATGGAAAGCATTAATGCAAGCAAAATGTTTCAGTGAACACATTTCAACAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAATGCCAGCATTTGGATTTTTTTAAAATAAGTAAATTTCTTATTGACGGCAACTAAATGGTGTTTGTAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTACATACAAGTACATGTTTTTAATGTTGTCAGTCTTCTGTGCTGTTCCTGTAAGTTTGCTATTAAAATACATTAAACTAT