Transcript asmbl_19970

Sequence
Transcript Sequence for observation asmbl_19970 of TGE0000502:
CCAGGGGGCGCTGTGTGGCTCCCGAGTAGGCTCAGAGCGACCGTGGCCGGGCGGAAGCGGCTTTCTGGCCTAAGCTTTAACAGGCTTCGCCTGTGCTTCCTGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGGTTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAGGTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAGCTTTTGGACTTCGGCAGTCTGTCCAACCTTCAGGTCACTCAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAATCTGGGACAACAGC