Transcript asmbl_59432

Sequence
Transcript Sequence for observation asmbl_59432 of TGE0003105:
CGCGACGCCATTTGCCACTGCCGAGCGTGGGCACGGGAGGCTCTCGCAAGCACGGGTGACCAGCCTCTCCTGAGCACGCTTCCCGACCTCCCGCACGGTCTTCGTGGCGCGCACTTCTCGGCGTTGCCCGTCGGAGTCACCGCAGTTCCTGCCGCCAGCCTGAGTGCGGTCCCACACGCTGCCAGCCAGTCTTTGCGGCCATGCCCAAGAATAAAGGAAAAGGAGGCAAAAACCGGCGTAGAGGCAAAAATGAGAATGAATCTGAAAAGCGAGAGCTTGTGTTCAAGGAGGATGGGCAAGAATATGCTCAAGTAATCAAAATGTTGGGAAACGGACGATTAGAAGCCATGTGTTTTGATGGTGTAAAGAGACTGTGCCACATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGATATCATATTGGTGGGGCTACGAGATTACCAGGACAACAAAGCCGATGTCATTTTAAAATACAACGCAGATGAAGCTAGAAGTCTCAAGGCCTATGGCGAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATTCAGTTTGATGACATTGGGGATGATGATGAAGACATCGATGATATCTAAAGCGAACTCAACATTTTACATTCCAGTCTTCCGGAAGATTGTCCTTCAAGTTTGGAATCTGGCCATAGACCTCAAAGAAAAATTTTCACTATCATCTTAATTGTAATTTGTTGAGGCAGATTTGATATTACAGTCTTTGAAAAACTGTTAACTGATACGCTAAGTCCACTTTGTTGATTCGATTCAATGGTCCTTAAGACTGTTTAAGACAAAAAGCCTTTCCTACTTTGACCCCTTCCAGTAAGTAAATGGGTGTTTTGAATAAACCATTTGCCTTGTGCTCAGTATAAAGTATGACTAAGCCCTGCCTTTGCATAGCTGTTGACTGGACAGTCTTTGTGTATATTCCAGTTGCCCAGAGATTTTGATACACATGGAGGCAGAAATCTGTGTTTTGTTTTTGTTCTATTTTGAGACAGAGTCTAACTTTGTATCTGAGGCTAGCTTGGAGTTCACTGTAGTGCTGGTGGACCTCAGACTTGCTGGGATCCTCCTGAGTGCTAAGGGCATATGTATGTACCACCATACCTGGCAGAAATCTATTTAAAGGCAAAAATGATAGGTCTGCGTTTCATATTTAAGTATGTGGCTATTTTTATACTGGTTTTGATACCATGTACATTTTTTTTCATGATTTTATTTTGCAGTCATCGGCTTACTGGAGGAGGAAAGGCATTTCCAAAATGGTTTTTTGGGTTTGGAGGTTTGTTTGTGGGCGGGGAGTGTTGAGACAGGGTTACTTTGTGTGGCCCTAGCGATAATGAAACTCACTCTGTACACCAGGCTGGCCTCAAGCTCAAAGACGTTTTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAG