Transcript asmbl_58579

Sequence
Transcript Sequence for observation asmbl_58579 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGCGACGACTTACTCCCGGCAGGGACTGAGGACTACATTCATATAAGGATCCAGCAGCGCAACGGCAGGAAGACGCTGACCACTGTGCAGGGCATTGCGGACGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGCAATGGAACTGTGATTGAACACCCTGAGTACGGAGAGGTTATTCAGCTTCAAGGGGACCAAAGGAAGAACATCTGCCAGTTTCTTCTGGAGGTTGGCATCGTCAAGGAGGAGCAGCTGAAGGTTCACGGGTTCTAAGATGAACCCAAGCGTGGCGAGTTTCTTAAATGGTTTTGTTCTCTAACTCAGTTTGGCTGCCTCGGGAGATGATTCTTTACAGTAAACGACAGACTTTGCGTTTATTTAATCATTCAGACTTCCACTCACACCTGCATGGCTACAGAAAACACGGGGTATGTAGGCTCCTGAGTCATAAGGAAATCGCGGTGAGATGGGAACGAAGCCCGAGTCCGTCCTAACATGTTTCCAATGGAAAAGGTTTTGTTGTGAGTGTTTGTTGTTAGTTTTATTTTCACTTGACTGTTAAATGTTTTTGTTGTTGTATTAAACCATGTATGTTGCGGCTTAACAATAAAAAGAAAGTGTGC