Transcript asmbl_41210

Sequence
Transcript Sequence for observation asmbl_41210 of TGE0005472:
CATGAGGGAAGGCCCGGGAGGGAGGACTTGGCTTGTGCTTGTCTCACTCTGCTCTGATCCTCCATGTTGCCTGGATTTAGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAG